Opened 6 months ago

Closed 6 months ago

Last modified 6 months ago

#19460 closed defect (can't reproduce)

H-Bonds: More than 2 coplanar positions specified

Reported by: shabir.najmudin@… Owned by: Eric Pettersen
Priority: normal Milestone:
Component: Structure Analysis Version:
Keywords: Cc:
Blocked By: Blocking:
Notify when closed: Platform: all
Project: ChimeraX

Description

The following bug report has been submitted:
Platform:        Linux-5.5.8-1.el8.elrepo.x86_64-x86_64-with-glibc2.28
ChimeraX Version: 1.3rc202111090815 (2021-11-09 08:15:14 UTC)
Description
(Describe the actions that caused this problem to occur here)

Log:
UCSF ChimeraX version: 1.3rc202111090815 (2021-11-09)  
© 2016-2021 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> open
> /home/shabir/Topos_CTD/ATPase_CTD/RealSpaceRefine_8/SpTopoIV_ATPase_CTD_X-
> cryoEM_RSR24_rsr_007-coot-0_real_space_refined_008.pdb format pdb

Chain information for SpTopoIV_ATPase_CTD_X-
cryoEM_RSR24_rsr_007-coot-0_real_space_refined_008.pdb #1  
---  
Chain | Description  
A | No description available  
C | No description available  
D | No description available  
  

> close

> open /home/shabir/Topo_EM_figs/T14mer_B-DNA.pdb
> /home/shabir/Topo_EM_figs/E26mer_B-DNA.pdb
> /home/shabir/Topo_EM_figs/side_J484_rsr7.pdb
> /home/shabir/Topo_EM_figs/front_J479_rsr9.pdb
> /home/shabir/Topo_EM_figs/SpTopoIV_8qmb5j5pq_on_4i3h-rev.pdb
> /home/shabir/Topo_EM_figs/SpTopoIV_8qmb5j5p_2xflexCTDs_model.pdb
> /home/shabir/Topo_EM_figs/SpTopoIV_8qmb5j5pq_on_4i3h.pdb
> /home/shabir/Topo_EM_figs/pinwheel_J238_Zflip_rsr26.pdb

Summary of feedback from opening /home/shabir/Topo_EM_figs/front_J479_rsr9.pdb  
---  
warnings | Cannot find LINK/SSBOND residue K (1 )  
Cannot find LINK/SSBOND residue K (1 )  
Cannot find LINK/SSBOND residue K (1 )  
  
Chain information for T14mer_B-DNA.pdb #1  
---  
Chain | Description  
A B | No description available  
  
Chain information for E26mer_B-DNA.pdb #2  
---  
Chain | Description  
A | No description available  
B | No description available  
  
Chain information for side_J484_rsr7.pdb #3  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
D | No description available  
E | No description available  
F | No description available  
G | No description available  
H | No description available  
  
Chain information for front_J479_rsr9.pdb #4  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
D | No description available  
E | No description available  
F | No description available  
G | No description available  
H | No description available  
  
Chain information for SpTopoIV_8qmb5j5pq_on_4i3h-rev.pdb #5  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
D | No description available  
E | No description available  
F | No description available  
G | No description available  
H | No description available  
Q | No description available  
  
Chain information for SpTopoIV_8qmb5j5p_2xflexCTDs_model.pdb #6  
---  
Chain | Description  
A B | No description available  
C | No description available  
D | No description available  
E | No description available  
F | No description available  
G | No description available  
H | No description available  
  
Chain information for SpTopoIV_8qmb5j5pq_on_4i3h.pdb #7  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
D | No description available  
E | No description available  
F | No description available  
G | No description available  
H | No description available  
Q | No description available  
  
Chain information for pinwheel_J238_Zflip_rsr26.pdb #8  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
D | No description available  
E | No description available  
F | No description available  
G | No description available  
H | No description available  
  

> color bynucleotide

> hide #1 models

> hide #2 models

> show #1 models

> show #2 models

> hide #1 models

> hide #2 models

> open /home/shabir/Topos_CTD/T14merA_pinwheel_5J5Q.pdb

Summary of feedback from opening
/home/shabir/Topos_CTD/T14merA_pinwheel_5J5Q.pdb  
---  
warnings | Start residue of secondary structure not found: SHEET 1 AA1 2 GLN A
18 VAL A 19 0  
Start residue of secondary structure not found: SHEET 2 AA1 2 ALA B 105 GLY B
106 -1  
Start residue of secondary structure not found: SHEET 1 AA2 3 LYS A 155 PRO A
156 0  
Start residue of secondary structure not found: SHEET 2 AA2 3 ALA A 144 GLU A
151 -1  
Start residue of secondary structure not found: SHEET 3 AA2 3 LYS A 161 THR A
165 -1  
69 messages similar to the above omitted  
  
Chain information for T14merA_pinwheel_5J5Q.pdb #9  
---  
Chain | Description  
E F | No description available  
  

> color #5,7-9#!3-4,6 bynucleotide

> hide #!3 models

> color #5,7-9#!4,6 bynucleotide

> select #9

603 atoms, 673 bonds, 29 residues, 1 model selected  

> hide #!4 models

> hide #5 models

> hide #!6 models

> hide #7 models

> hide #8 models

> show sel surfaces

> ~select #9

2 models selected  

> show #8 models

> select #9

603 atoms, 673 bonds, 29 residues, 1 model selected  

> ui mousemode right "translate selected models"

> view matrix models #9,1,0,0,-3.0993,0,1,0,-4.6498,0,0,1,-7.3089

> view matrix models #9,1,0,0,-5.2235,0,1,0,-6.0613,0,0,1,-6.1341

> view matrix models #9,1,0,0,-6.3816,0,1,0,-6.1306,0,0,1,-7.8567

> view matrix models #9,1,0,0,-2.9224,0,1,0,-22.22,0,0,1,-0.21635

> view matrix models #9,1,0,0,-1.8316,0,1,0,-22.573,0,0,1,-0.033346

> view matrix models #9,1,0,0,-1.9487,0,1,0,-23.809,0,0,1,-0.81871

> view matrix models #9,1,0,0,-2.0034,0,1,0,-23.645,0,0,1,-0.32886

> view matrix models #9,1,0,0,-3.0617,0,1,0,-23.635,0,0,1,0.14824

> view matrix models #9,1,0,0,-2.7272,0,1,0,-26.233,0,0,1,2.4442

> view matrix models #9,1,0,0,-1.3285,0,1,0,-25.35,0,0,1,-0.22106

> view matrix models #9,1,0,0,-2.6177,0,1,0,-25.301,0,0,1,-1.0128

> view matrix models #9,1,0,0,-2.4201,0,1,0,-25.366,0,0,1,-0.53708

> ui mousemode right "rotate selected models"

> view matrix models
> #9,0.9986,0.003658,0.052837,-14.464,-0.0057742,0.99918,0.039956,-33.095,-0.052647,-0.040205,0.9978,15.379

> view matrix models
> #9,0.98934,0.096137,0.1094,-40.703,-0.10879,0.98724,0.11631,-30.806,-0.096826,-0.12697,0.98717,39.438

> ui mousemode right "translate selected models"

> view matrix models
> #9,0.98934,0.096137,0.1094,-39.1,-0.10879,0.98724,0.11631,-30.75,-0.096826,-0.12697,0.98717,42.508

> view matrix models
> #9,0.98934,0.096137,0.1094,-43.187,-0.10879,0.98724,0.11631,-29.912,-0.096826,-0.12697,0.98717,42.162

> view matrix models
> #9,0.98934,0.096137,0.1094,-43.175,-0.10879,0.98724,0.11631,-29.75,-0.096826,-0.12697,0.98717,42.719

> view matrix models
> #9,0.98934,0.096137,0.1094,-42.882,-0.10879,0.98724,0.11631,-29.592,-0.096826,-0.12697,0.98717,42.873

> ~select #9

2 models selected  

> ui tool show "2D Builder"

Please register the custom scheme 'editor' via
QWebEngineUrlScheme::registerScheme() before installing the custom scheme
handler.  

> ui tool show "Build Structure"

> build start nucleic T56mer_BDNA
> GCATATATATATGCGGTACGTGCGGATTGCGCTTAGACGTATGCAGGGATCGTACGA type dna form B

Chain information for T56mer_BDNA #10  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> build start nucleic T72mer_BDNA
> GCATATATATATGCGGTACGTGCGGATTGCGCTTAGACGTATGCAGGGATCGTACGATGACGATTGCATTACG
> type dna form B

Chain information for T72mer_BDNA #11  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> save /home/shabir/Topos_CTD/T56mer_BDNA.pdb models #10

> save /home/shabir/Topos_CTD/T72mer_BDNA.pdb models #11

> open /home/shabir/Topos_CTD/T14merA_pinwheel_5J5Q.pdb

Summary of feedback from opening
/home/shabir/Topos_CTD/T14merA_pinwheel_5J5Q.pdb  
---  
warnings | Start residue of secondary structure not found: SHEET 1 AA1 2 GLN A
18 VAL A 19 0  
Start residue of secondary structure not found: SHEET 2 AA1 2 ALA B 105 GLY B
106 -1  
Start residue of secondary structure not found: SHEET 1 AA2 3 LYS A 155 PRO A
156 0  
Start residue of secondary structure not found: SHEET 2 AA2 3 ALA A 144 GLU A
151 -1  
Start residue of secondary structure not found: SHEET 3 AA2 3 LYS A 161 THR A
165 -1  
69 messages similar to the above omitted  
  
Chain information for T14merA_pinwheel_5J5Q.pdb #12  
---  
Chain | Description  
E F | No description available  
  

> hide #!9 models

> show #!9 models

> show #1 models

> coulombic #1,8,10-12#!9

The following residues are missing heavy (non-hydrogen) atoms, which may
result in inaccurate electrostatics:  
T14mer_B-DNA.pdb #1/B C 13  
T14mer_B-DNA.pdb #1/B C 13  
T14mer_B-DNA.pdb #1/B G 13  
T14mer_B-DNA.pdb #1/B A 13  
T14mer_B-DNA.pdb #1/B A 13  
T14mer_B-DNA.pdb #1/B A 13  
T14mer_B-DNA.pdb #1/B A 13  
T14mer_B-DNA.pdb #1/B A 13  
T14mer_B-DNA.pdb #1/B G 13  
pinwheel_J238_Zflip_rsr26.pdb #8/C LYS 4  
pinwheel_J238_Zflip_rsr26.pdb #8/C GLU 20  
pinwheel_J238_Zflip_rsr26.pdb #8/C MET 90  
pinwheel_J238_Zflip_rsr26.pdb #8/C LYS 154  
pinwheel_J238_Zflip_rsr26.pdb #8/C LYS 160  
pinwheel_J238_Zflip_rsr26.pdb #8/C LYS 167  
pinwheel_J238_Zflip_rsr26.pdb #8/C SER 168  
pinwheel_J238_Zflip_rsr26.pdb #8/C LYS 205  
pinwheel_J238_Zflip_rsr26.pdb #8/C GLU 225  
pinwheel_J238_Zflip_rsr26.pdb #8/C ASP 238  
pinwheel_J238_Zflip_rsr26.pdb #8/C GLU 240  
pinwheel_J238_Zflip_rsr26.pdb #8/C ASN 253  
pinwheel_J238_Zflip_rsr26.pdb #8/C GLN 256  
pinwheel_J238_Zflip_rsr26.pdb #8/C LYS 296  
pinwheel_J238_Zflip_rsr26.pdb #8/C LYS 311  
pinwheel_J238_Zflip_rsr26.pdb #8/C LYS 313  
pinwheel_J238_Zflip_rsr26.pdb #8/C ARG 353  
pinwheel_J238_Zflip_rsr26.pdb #8/C GLU 370  
pinwheel_J238_Zflip_rsr26.pdb #8/C GLU 390  
pinwheel_J238_Zflip_rsr26.pdb #8/C ARG 393  
pinwheel_J238_Zflip_rsr26.pdb #8/C LYS 394  
pinwheel_J238_Zflip_rsr26.pdb #8/D GLU 20  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 154  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 161  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 167  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 169  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 205  
pinwheel_J238_Zflip_rsr26.pdb #8/D GLU 225  
pinwheel_J238_Zflip_rsr26.pdb #8/D ASP 238  
pinwheel_J238_Zflip_rsr26.pdb #8/D ASP 265  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 296  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 311  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 313  
pinwheel_J238_Zflip_rsr26.pdb #8/D GLU 370  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 384  
pinwheel_J238_Zflip_rsr26.pdb #8/D GLU 390  
pinwheel_J238_Zflip_rsr26.pdb #8/D ARG 393  
pinwheel_J238_Zflip_rsr26.pdb #8/D LYS 394  
pinwheel_J238_Zflip_rsr26.pdb #8/D ARG 396  
pinwheel_J238_Zflip_rsr26.pdb #8/D GLU 398  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B A 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B G 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B C 56  
T56mer_BDNA #10/B A 56  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B G 72  
T72mer_BDNA #11/B C 72  
T72mer_BDNA #11/B A 72  
T72mer_BDNA #11/B A 72  

Deleting 5' phosphates from: copy of pinwheel_J238_Zflip_rsr26.pdb #/F DA 1,
copy of pinwheel_J238_Zflip_rsr26.pdb #/H DG 1  
Using Amber 20 recommended default charges and atom types for standard
residues  
[Repeated 5 time(s)]Coulombic values for T14mer_B-DNA.pdb_A SES surface #1.1:
minimum, -13.70, mean -9.23, maximum -1.20  
Coulombic values for T14mer_B-DNA.pdb_B SES surface #1.2: minimum, -14.76,
mean -10.13, maximum -1.83  
Coulombic values for pinwheel_J238_Zflip_rsr26.pdb_A SES surface #8.1:
minimum, -21.83, mean -2.08, maximum 16.59  
Coulombic values for pinwheel_J238_Zflip_rsr26.pdb_B SES surface #8.2:
minimum, -18.74, mean -1.45, maximum 14.32  
Coulombic values for pinwheel_J238_Zflip_rsr26.pdb_C SES surface #8.3:
minimum, -21.76, mean -2.30, maximum 17.54  
Coulombic values for pinwheel_J238_Zflip_rsr26.pdb_D SES surface #8.4:
minimum, -21.65, mean -2.29, maximum 16.87  
Coulombic values for pinwheel_J238_Zflip_rsr26.pdb_E SES surface #8.5:
minimum, -18.12, mean -8.12, maximum -0.35  
Coulombic values for pinwheel_J238_Zflip_rsr26.pdb_F SES surface #8.6:
minimum, -17.92, mean -8.92, maximum -1.64  
Coulombic values for pinwheel_J238_Zflip_rsr26.pdb_G SES surface #8.7:
minimum, -18.45, mean -8.13, maximum -0.25  
Coulombic values for pinwheel_J238_Zflip_rsr26.pdb_H SES surface #8.8:
minimum, -24.22, mean -9.01, maximum -0.72  
Coulombic values for T56mer_BDNA_A SES surface #10.1: minimum, -15.64, mean
-11.45, maximum -1.73  
Coulombic values for T56mer_BDNA_B SES surface #10.2: minimum, -17.54, mean
-12.81, maximum -1.84  
Coulombic values for T72mer_BDNA_A SES surface #11.1: minimum, -16.08, mean
-11.67, maximum -1.13  
Coulombic values for T72mer_BDNA_B SES surface #11.2: minimum, -17.71, mean
-13.05, maximum -2.59  
Coulombic values for T14merA_pinwheel_5J5Q.pdb_E SES surface #12.1: minimum,
-17.38, mean -9.00, maximum -0.81  
Coulombic values for T14merA_pinwheel_5J5Q.pdb_F SES surface #12.2: minimum,
-16.15, mean -8.94, maximum -0.31  
Coulombic values for T14merA_pinwheel_5J5Q.pdb_E SES surface #9.1: minimum,
-17.38, mean -9.00, maximum -0.81  
Coulombic values for T14merA_pinwheel_5J5Q.pdb_F SES surface #9.2: minimum,
-16.15, mean -8.94, maximum -0.31  
To also show corresponding color key, enter the above coulombic command and
add key true  

> hide #!11 models

> hide #!1 models

> show #!1 models

> hide #!1 models

> show #!1 models

> hide #!9 models

> hide #!10 models

> color #!1,8,12 bynucleotide

[Repeated 1 time(s)]

> hide #!12 models

> show #!12 models

> hide #!1 models

> show #!9 models

> hide #!9 models

> show #!9 models

> color #!8-9,12 bynucleotide

[Repeated 1 time(s)]

> nucleotides #!8-9,12 atoms

> style nucleic & #!8-9,12 stick

Changed 2108 atom styles  

> build start nucleic T88mer_BDNA
> GCATATATATATGCGGTACGTGCGGATTGCGCTTAGACGTATGCAGGGATCGTACGATGACGATTGCATTACGATGCATATATATATGC
> type dna form B

Chain information for T88mer_BDNA #13  
---  
Chain | Description  
A | No description available  
B | No description available  
  

> select #13

3643 atoms, 4086 bonds, 178 residues, 1 model selected  

> ui mousemode right "translate selected models"

> view matrix models #13,1,0,0,0.55824,0,1,0,-0.11646,0,0,1,6.5459

> view matrix models #13,1,0,0,-1.9729,0,1,0,1.5698,0,0,1,9.1859

> ui mousemode right "rotate selected models"

> view matrix models
> #13,0.75963,0.15233,0.63226,-93.156,-0.1701,0.98488,-0.032919,37.452,-0.62771,-0.082543,0.77406,163.43

> view matrix models
> #13,0.75106,0.18482,0.63384,-97.315,-0.20122,0.97842,-0.046866,45.942,-0.62882,-0.09234,0.77205,165.55

> ui mousemode right "translate selected models"

> view matrix models
> #13,0.75106,0.18482,0.63384,-96.682,-0.20122,0.97842,-0.046866,45.671,-0.62882,-0.09234,0.77205,165.51

> view matrix models
> #13,0.75106,0.18482,0.63384,-100.39,-0.20122,0.97842,-0.046866,46.72,-0.62882,-0.09234,0.77205,164.69

> ~select #13

Nothing selected  

> ui tool show "Build Structure"

> toolshed show

Downloading bundle MolecularDynamicsViewer-1.6-py3-none-any.whl  
Bundle installation canceled  
Downloading bundle ChimeraX_ISOLDE-1.3-cp39-cp39-manylinux_2_17_x86_64.whl  

> hide #!8 models

> hide #!9 models

> hide #!12 models

> hide #13 models

> open /home/shabir/Topos_CTD/Marks_model_CTD-coot-0.pdb
> /home/shabir/Topos_CTD/Marks_model_T14-72mer_G-E18mer-coot-1.pdb

Chain information for Marks_model_CTD-coot-0.pdb #14  
---  
Chain | Description  
A | No description available  
  
Chain information for Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15  
---  
Chain | Description  
A | No description available  
B | No description available  
C | No description available  
D | No description available  
E | No description available  
F | No description available  
G | No description available  
H | No description available  
J L | No description available  
M | No description available  
N | No description available  
P | No description available  
Q | No description available  
  

> coulombic #14-15

The following residues are missing heavy (non-hydrogen) atoms, which may
result in inaccurate electrostatics:  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 4  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 20  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C MET 90  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 154  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 160  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 167  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C SER 168  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 205  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 225  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C ASP 238  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 240  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C ASN 253  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLN 256  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 296  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 311  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 313  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C ARG 353  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 370  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 390  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C ARG 393  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 394  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 20  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 154  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 161  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 167  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 169  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 205  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 225  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D ASP 238  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D ASP 265  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 296  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 311  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 313  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 370  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 384  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 390  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D ARG 393  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 394  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D ARG 396  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 398  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DG 9  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DC 10  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DC 11  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DA 12  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DT 13  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DT 14  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DC 15  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DA 16  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DT 17  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DG 18  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DA 2  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DT 3  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DG 4  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DA 5  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DA 6  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DT 7  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DG 8  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DG 9  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DC 10  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DC 11  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DA 12  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/Q G 72  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/Q A 72  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/Q C 72  

Traceback (most recent call last):  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/toolbar/tool.py", line 205, in callback  
bundle_info.run_provider(session, name, session.toolbar,
display_name=display_name)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/core/toolshed/info.py", line 381, in run_provider  
return api._api_caller.run_provider(api, session, name, mgr, **kw)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/core/toolshed/__init__.py", line 1284, in run_provider  
return cls._get_func(api, "run_provider")(session, name, mgr, **kw)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/__init__.py", line 52, in run_provider  
shortcuts.run_provider(session, name)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 1334, in run_provider  
keyboard_shortcuts(session).try_shortcut(name)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 390, in try_shortcut  
self.run_shortcut(keys)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 408, in run_shortcut  
sc.run(self.session, status = self._enabled)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 327, in run  
f(s)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 61, in func_plus_tip  
func(cmd + " %s")(session)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 569, in run_expanded_command  
run(session, cmd)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 512, in run  
run_command(session, command, **kw)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/core/commands/run.py", line 36, in run  
results = command.run(text, log=log, return_json=return_json)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/core/commands/cli.py", line 2856, in run  
result = ci.function(session, **kw_args)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/coulombic/cmd.py", line 90, in cmd_coulombic  
assign_charges(session, needs_assignment, his_scheme, charge_method,  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/coulombic/coulombic.py", line 80, in assign_charges  
cmd_addh(session, addh_structures, hbond=hbond)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/addh/cmd.py", line 62, in cmd_addh  
add_h_func(session, structures, template=template, in_isolation=in_isolation,
**prot_schemes)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/addh/cmd.py", line 169, in hbond_add_hydrogens  
add_hydrogens(session, atoms, type_info_for_atom, naming_schemas,
hydrogen_totals,  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/addh/hbond.py", line 249, in add_hydrogens  
hbonds = find_hbonds(session, s_list, dist_slop=rec_dist_slop,
angle_slop=rec_angle_slop)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/hbonds/hbond.py", line 603, in find_hbonds  
if not geom_func(donor_atom, donor_hyds, *args):  
TypeError: acc_phi_psi() takes 8 positional arguments but 46 were given  
  
TypeError: acc_phi_psi() takes 8 positional arguments but 46 were given  
  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/hbonds/hbond.py", line 603, in find_hbonds  
if not geom_func(donor_atom, donor_hyds, *args):  
  
See log for complete Python traceback.  
  

> select #14

2598 atoms, 2638 bonds, 326 residues, 1 model selected  

> select #15

25776 atoms, 27744 bonds, 2816 residues, 1 model selected  

> coulombic sel

The following residues are missing heavy (non-hydrogen) atoms, which may
result in inaccurate electrostatics:  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 4  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 20  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C MET 90  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 154  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 160  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 167  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C SER 168  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 205  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 225  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C ASP 238  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 240  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C ASN 253  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLN 256  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 296  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 311  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 313  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C ARG 353  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 370  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C GLU 390  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C ARG 393  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/C LYS 394  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 20  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 154  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 161  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 167  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 169  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 205  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 225  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D ASP 238  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D ASP 265  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 296  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 311  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 313  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 370  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 384  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 390  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D ARG 393  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D LYS 394  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D ARG 396  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/D GLU 398  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DG 9  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DC 10  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DC 11  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DA 12  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DT 13  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DT 14  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DC 15  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DA 16  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DT 17  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/M DG 18  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DA 2  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DT 3  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DG 4  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DA 5  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DA 6  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DT 7  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DG 8  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DG 9  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DC 10  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DC 11  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/N DA 12  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/Q G 72  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/Q A 72  
Marks_model_T14-72mer_G-E18mer-coot-1.pdb #15/Q C 72  

Traceback (most recent call last):  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/toolbar/tool.py", line 205, in callback  
bundle_info.run_provider(session, name, session.toolbar,
display_name=display_name)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/core/toolshed/info.py", line 381, in run_provider  
return api._api_caller.run_provider(api, session, name, mgr, **kw)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/core/toolshed/__init__.py", line 1284, in run_provider  
return cls._get_func(api, "run_provider")(session, name, mgr, **kw)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/__init__.py", line 52, in run_provider  
shortcuts.run_provider(session, name)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 1334, in run_provider  
keyboard_shortcuts(session).try_shortcut(name)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 390, in try_shortcut  
self.run_shortcut(keys)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 408, in run_shortcut  
sc.run(self.session, status = self._enabled)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 327, in run  
f(s)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 61, in func_plus_tip  
func(cmd + " %s")(session)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 569, in run_expanded_command  
run(session, cmd)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/shortcuts/shortcuts.py", line 512, in run  
run_command(session, command, **kw)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/core/commands/run.py", line 36, in run  
results = command.run(text, log=log, return_json=return_json)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/core/commands/cli.py", line 2856, in run  
result = ci.function(session, **kw_args)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/coulombic/cmd.py", line 90, in cmd_coulombic  
assign_charges(session, needs_assignment, his_scheme, charge_method,  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/coulombic/coulombic.py", line 80, in assign_charges  
cmd_addh(session, addh_structures, hbond=hbond)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/addh/cmd.py", line 62, in cmd_addh  
add_h_func(session, structures, template=template, in_isolation=in_isolation,
**prot_schemes)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/addh/cmd.py", line 169, in hbond_add_hydrogens  
add_hydrogens(session, atoms, type_info_for_atom, naming_schemas,
hydrogen_totals,  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/addh/hbond.py", line 249, in add_hydrogens  
hbonds = find_hbonds(session, s_list, dist_slop=rec_dist_slop,
angle_slop=rec_angle_slop)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/hbonds/hbond.py", line 574, in find_hbonds  
donor_hyds = hyd_positions(donor_atom)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/hbonds/hydpos.py", line 77, in hyd_positions  
bond_positions(heavy_loc, geom, bond_len, bonded_locs, coplanar=coplanar))  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/atomic/bond_geom.py", line 73, in bond_positions  
return planar_pos(bondee, bonded, bond_len, coplanar, toward, away, toward2,
away2)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/atomic/bond_geom.py", line 129, in planar_pos  
pos = angle_pos(bondee, cur_bonded[0], bond_len, 120.0, coplanar)  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/atomic/bond_geom.py", line 231, in angle_pos  
raise ValueError("More than 2 coplanar positions specified!")  
ValueError: More than 2 coplanar positions specified!  
  
ValueError: More than 2 coplanar positions specified!  
  
File "/usr/libexec/UCSF-ChimeraX/lib/python3.9/site-
packages/chimerax/atomic/bond_geom.py", line 231, in angle_pos  
raise ValueError("More than 2 coplanar positions specified!")  
  
See log for complete Python traceback.  
  

> select #14

2598 atoms, 2638 bonds, 326 residues, 1 model selected  

> ~select #15

2598 atoms, 2638 bonds, 326 residues, 1 model selected  




OpenGL version: 3.3.0 NVIDIA 440.64
OpenGL renderer: GeForce RTX 2080 SUPER/PCIe/SSE2
OpenGL vendor: NVIDIA Corporation
Manufacturer: System manufacturer
Model: System Product Name
OS: CentOS Stream 8 
Architecture: 64bit ELF
Virutal Machine: none
CPU: 32 AMD Ryzen 9 3950X 16-Core Processor
Cache Size: 512 KB
Memory:
	              total        used        free      shared  buff/cache   available
	Mem:           78Gi        32Gi        27Gi       4.2Gi        18Gi        41Gi
	Swap:         7.9Gi          0B       7.9Gi

Graphics:
	09:00.0 VGA compatible controller [0300]: NVIDIA Corporation TU104 [GeForce RTX 2080 SUPER] [10de:1e81] (rev a1)	
	Subsystem: eVga.com. Corp. Device [3842:3081]	
	Kernel driver in use: nvidia
Locale: ('en_GB', 'UTF-8')
PyQt5 5.15.2, Qt 5.15.2
Installed Packages:
    alabaster: 0.7.12
    appdirs: 1.4.4
    argcomplete: 3.6.0
    attrs: 25.3.0
    Babel: 2.9.1
    backcall: 0.2.0
    basis-set-exchange: 0.11
    blockdiag: 2.0.1
    certifi: 2021.10.8
    cftime: 1.5.1.1
    charset-normalizer: 2.0.7
    ChimeraX-AddCharge: 1.1.5
    ChimeraX-AddH: 2.1.10
    ChimeraX-AlignmentAlgorithms: 2.0
    ChimeraX-AlignmentHdrs: 3.2
    ChimeraX-AlignmentMatrices: 2.0
    ChimeraX-Alignments: 2.2.3
    ChimeraX-AlphaFold: 1.0
    ChimeraX-AltlocExplorer: 1.0.1
    ChimeraX-AmberInfo: 1.0
    ChimeraX-Arrays: 1.0
    ChimeraX-Atomic: 1.30.2
    ChimeraX-AtomicLibrary: 4.1.5
    ChimeraX-AtomSearch: 2.0
    ChimeraX-AtomSearchLibrary: 1.0
    ChimeraX-AxesPlanes: 2.0
    ChimeraX-BasicActions: 1.1
    ChimeraX-BILD: 1.0
    ChimeraX-BlastProtein: 2.0
    ChimeraX-BondRot: 2.0
    ChimeraX-BugReporter: 1.0
    ChimeraX-BuildStructure: 2.6
    ChimeraX-Bumps: 1.0
    ChimeraX-BundleBuilder: 1.1
    ChimeraX-ButtonPanel: 1.0
    ChimeraX-CageBuilder: 1.0
    ChimeraX-CellPack: 1.0
    ChimeraX-Centroids: 1.2
    ChimeraX-ChemGroup: 2.0
    ChimeraX-Clashes: 2.2.2
    ChimeraX-ColorActions: 1.0
    ChimeraX-ColorGlobe: 1.0
    ChimeraX-ColorKey: 1.5
    ChimeraX-CommandLine: 1.1.5
    ChimeraX-ConnectStructure: 2.0
    ChimeraX-Contacts: 1.0
    ChimeraX-Core: 1.3rc202111090815
    ChimeraX-CoreFormats: 1.1
    ChimeraX-coulombic: 1.3.1
    ChimeraX-Crosslinks: 1.0
    ChimeraX-Crystal: 1.0
    ChimeraX-CrystalContacts: 1.0
    ChimeraX-DataFormats: 1.2.2
    ChimeraX-Dicom: 1.0
    ChimeraX-DistMonitor: 1.1.5
    ChimeraX-DistUI: 1.0
    ChimeraX-Dssp: 2.0
    ChimeraX-EMDB-SFF: 1.0
    ChimeraX-ExperimentalCommands: 1.0
    ChimeraX-FileHistory: 1.0
    ChimeraX-FunctionKey: 1.0
    ChimeraX-Geometry: 1.1
    ChimeraX-gltf: 1.0
    ChimeraX-Graphics: 1.1
    ChimeraX-Hbonds: 2.1.2
    ChimeraX-Help: 1.2
    ChimeraX-HKCage: 1.3
    ChimeraX-IHM: 1.1
    ChimeraX-ImageFormats: 1.2
    ChimeraX-IMOD: 1.0
    ChimeraX-IO: 1.0.1
    ChimeraX-ItemsInspection: 1.0
    ChimeraX-Label: 1.1
    ChimeraX-LinuxSupport: 1.0
    ChimeraX-ListInfo: 1.1.1
    ChimeraX-Log: 1.1.4
    ChimeraX-LookingGlass: 1.1
    ChimeraX-Maestro: 1.8.1
    ChimeraX-Map: 1.1
    ChimeraX-MapData: 2.0
    ChimeraX-MapEraser: 1.0
    ChimeraX-MapFilter: 2.0
    ChimeraX-MapFit: 2.0
    ChimeraX-MapSeries: 2.1
    ChimeraX-Markers: 1.0
    ChimeraX-Mask: 1.0
    ChimeraX-MatchMaker: 2.0.4
    ChimeraX-MDcrds: 2.6
    ChimeraX-MedicalToolbar: 1.0.1
    ChimeraX-Meeting: 1.0
    ChimeraX-MLP: 1.1
    ChimeraX-mmCIF: 2.4
    ChimeraX-MMTF: 2.1
    ChimeraX-Modeller: 1.2.6
    ChimeraX-ModelPanel: 1.2.1
    ChimeraX-ModelSeries: 1.0
    ChimeraX-Mol2: 2.0
    ChimeraX-Morph: 1.0
    ChimeraX-MouseModes: 1.1
    ChimeraX-Movie: 1.0
    ChimeraX-Neuron: 1.0
    ChimeraX-Nucleotides: 2.0.2
    ChimeraX-OpenCommand: 1.7
    ChimeraX-PDB: 2.6.5
    ChimeraX-PDBBio: 1.0
    ChimeraX-PDBImages: 1.2
    ChimeraX-PDBLibrary: 1.0.2
    ChimeraX-PDBMatrices: 1.0
    ChimeraX-Phenix: 0.3
    ChimeraX-PickBlobs: 1.0
    ChimeraX-Positions: 1.0
    ChimeraX-PresetMgr: 1.0.1
    ChimeraX-PubChem: 2.1
    ChimeraX-ReadPbonds: 1.0
    ChimeraX-Registration: 1.1
    ChimeraX-RemoteControl: 1.0
    ChimeraX-ResidueFit: 1.0
    ChimeraX-RestServer: 1.1
    ChimeraX-RNALayout: 1.0
    ChimeraX-RotamerLibMgr: 2.0
    ChimeraX-RotamerLibsDunbrack: 2.0
    ChimeraX-RotamerLibsDynameomics: 2.0
    ChimeraX-RotamerLibsRichardson: 2.0
    ChimeraX-SaveCommand: 1.5
    ChimeraX-SchemeMgr: 1.0
    ChimeraX-SDF: 2.0
    ChimeraX-Segger: 1.0
    ChimeraX-Segment: 1.0
    ChimeraX-SelInspector: 1.0
    ChimeraX-SeqView: 2.4.6
    ChimeraX-Shape: 1.0.1
    ChimeraX-Shell: 1.0
    ChimeraX-Shortcuts: 1.1
    ChimeraX-ShowAttr: 1.0
    ChimeraX-ShowSequences: 1.0
    ChimeraX-SideView: 1.0
    ChimeraX-Smiles: 2.1
    ChimeraX-SmoothLines: 1.0
    ChimeraX-SpaceNavigator: 1.0
    ChimeraX-StdCommands: 1.6
    ChimeraX-STL: 1.0
    ChimeraX-Storm: 1.0
    ChimeraX-Struts: 1.0
    ChimeraX-Surface: 1.0
    ChimeraX-SwapAA: 2.0
    ChimeraX-SwapRes: 2.1
    ChimeraX-TapeMeasure: 1.0
    ChimeraX-Test: 1.0
    ChimeraX-TestManager: 0.3
    ChimeraX-Toolbar: 1.1
    ChimeraX-ToolshedUtils: 1.2
    ChimeraX-Tug: 1.0
    ChimeraX-UI: 1.13.7
    ChimeraX-uniprot: 2.2
    ChimeraX-UnitCell: 1.0
    ChimeraX-ViewDockX: 1.0.1
    ChimeraX-VIPERdb: 1.0
    ChimeraX-Vive: 1.1
    ChimeraX-VolumeMenu: 1.0
    ChimeraX-VTK: 1.0
    ChimeraX-WavefrontOBJ: 1.0
    ChimeraX-WebCam: 1.0
    ChimeraX-WebServices: 1.0
    ChimeraX-Zone: 1.0
    colorama: 0.4.4
    cxservices: 1.1
    cycler: 0.11.0
    Cython: 0.29.24
    decorator: 5.1.0
    distro: 1.6.0
    docutils: 0.17.1
    filelock: 3.0.12
    flake8: 4.0.1
    funcparserlib: 0.3.6
    grako: 3.16.5
    h5py: 3.5.0
    html2text: 2020.1.16
    idna: 3.3
    ihm: 0.21
    imagecodecs: 2021.4.28
    imagesize: 1.2.0
    ipykernel: 5.5.5
    ipython: 7.23.1
    ipython-genutils: 0.2.0
    jedi: 0.18.0
    Jinja2: 3.0.1
    jsonschema: 4.23.0
    jsonschema-specifications: 2024.10.1
    jupyter-client: 6.1.12
    jupyter-core: 4.9.1
    kiwisolver: 1.3.2
    line-profiler: 3.3.0
    lxml: 4.6.3
    lz4: 3.1.3
    MarkupSafe: 2.0.1
    matplotlib: 3.4.3
    matplotlib-inline: 0.1.3
    mccabe: 0.6.1
    MolecularDynamicsViewer: 1.6
    msgpack: 1.0.2
    mypy: 0.910
    mypy-extensions: 0.4.3
    netCDF4: 1.5.7
    networkx: 2.6.3
    numexpr: 2.7.3
    numpy: 1.21.2
    openvr: 1.16.801
    packaging: 21.2
    ParmEd: 3.2.0
    parso: 0.8.2
    pexpect: 4.8.0
    pickleshare: 0.7.5
    Pillow: 8.3.2
    pip: 22.1.2
    pkginfo: 1.7.1
    prompt-toolkit: 3.0.22
    psutil: 5.8.0
    ptyprocess: 0.7.0
    pycodestyle: 2.8.0
    pycollada: 0.7.1
    pydicom: 2.1.2
    pydocstyle: 6.1.1
    pyflakes: 2.4.0
    Pygments: 2.10.0
    PyOpenGL: 3.1.5
    PyOpenGL-accelerate: 3.1.5
    pyparsing: 2.4.7
    PyQt5-commercial: 5.15.2
    PyQt5-sip: 12.8.1
    PyQtWebEngine-commercial: 5.15.2
    python-dateutil: 2.8.2
    pytz: 2021.3
    pyzmq: 22.3.0
    qtconsole: 5.1.1
    QtPy: 1.11.2
    RandomWords: 0.3.0
    referencing: 0.36.2
    regex: 2024.11.6
    requests: 2.26.0
    rpds-py: 0.23.1
    scipy: 1.7.1
    Send2Trash: 1.8.0
    SEQCROW: 1.6.3
    setuptools: 57.5.0
    sfftk-rw: 0.7.1
    six: 1.16.0
    snowballstemmer: 2.1.0
    sortedcontainers: 2.4.0
    Sphinx: 4.2.0
    sphinx-autodoc-typehints: 1.12.0
    sphinxcontrib-applehelp: 1.0.2
    sphinxcontrib-blockdiag: 2.0.0
    sphinxcontrib-devhelp: 1.0.2
    sphinxcontrib-htmlhelp: 2.0.0
    sphinxcontrib-jsmath: 1.0.1
    sphinxcontrib-qthelp: 1.0.3
    sphinxcontrib-serializinghtml: 1.1.5
    suds-jurko: 0.6
    tables: 3.6.1
    tifffile: 2021.4.8
    tinyarray: 1.2.3
    toml: 0.10.2
    tornado: 6.1
    traitlets: 5.1.1
    typing-extensions: 4.12.2
    Unidecode: 1.3.8
    urllib3: 1.26.7
    wcwidth: 0.2.5
    webcolors: 1.11.1
    wheel: 0.37.0
    wheel-filename: 1.3.0

Change History (6)

comment:1 by Eric Pettersen, 6 months ago

Component: UnassignedStructure Analysis
Owner: set to Eric Pettersen
Platform: all
Project: ChimeraX
Status: newaccepted
Summary: ChimeraX bug report submissionH-Bonds: More than 2 coplanar positions specified

comment:2 by Eric Pettersen, 6 months ago

Resolution: can't reproduce
Status: acceptedclosed

Hi Shabir,

We don't really have the capability to diagnose problems in 4-year-old versions of ChimeraX. I suggest you upgrade to a current version of ChimeraX. There is a definite chance that the problem you are reporting has been fixed in the last 4 years. If not, please feel free to report the problem again.

--Eric

Eric Pettersen
UCSF Computer Graphics Lab

comment:3 by shabir.najmudin@…, 6 months ago

Dear Eric,

Thank you very much for getting back to me. I really appreciate you taking the time to do so. I didnt realise I was running such an old version of ChimeraX.

I just tried to upgrade to the latest version and have discovered that the problem is deeper. I am still running my linux on the old CentOS 08 system, which is no longer supported and needs to be upgraded to the latest version. The colleague who used to help me with this and to maintain everything (now I realised the amount of work he was doing) is no longer with us. He has moved to fresher pastures.

The plus side is now I've  upgraded ChimeraX to latest version on my laptop and I can use this until I get someone to help me upgrade the OS on my work station.

Thanks a million.

Cheers

Shabir
________________________________
From: ChimeraX <ChimeraX-bugs-admin@cgl.ucsf.edu>
Sent: 01 December 2025 22:48
To: Shabir Najmudin <shabir.najmudin@kcl.ac.uk>; pett@cgl.ucsf.edu <pett@cgl.ucsf.edu>
Subject: Re: [ChimeraX] #19460: H-Bonds: More than 2 coplanar positions specified

#19460: H-Bonds: More than 2 coplanar positions specified
-----------------------------------------+----------------------------
          Reporter:  shabir.najmudin@…   |      Owner:  Eric Pettersen
              Type:  defect              |     Status:  closed
          Priority:  normal              |  Milestone:
         Component:  Structure Analysis  |    Version:
        Resolution:  can't reproduce     |   Keywords:
        Blocked By:                      |   Blocking:
Notify when closed:                      |   Platform:  all
           Project:  ChimeraX            |
-----------------------------------------+----------------------------
Changes (by Eric Pettersen):

 * resolution:   => can't reproduce
 * status:  accepted => closed

Comment:

 Hi Shabir,
         We don't really have the capability to diagnose problems in 4
 -year-old versions of ChimeraX.  I suggest you upgrade to a current
 version of ChimeraX.  There is a definite chance that the problem you are
 reporting has been fixed in the last 4 years.  If not, please feel free to
 report the problem again.

 --Eric

         Eric Pettersen
         UCSF Computer Graphics Lab
--
Ticket URL: <https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.rbvi.ucsf.edu%2Ftrac%2FChimeraX%2Fticket%2F19460%23comment%3A2&data=05%7C02%7Cshabir.najmudin%40kcl.ac.uk%7C4e49d5c4328b4f5cf98e08de312bc235%7C8370cf1416f34c16b83c724071654356%7C0%7C0%7C639002261184585132%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=D%2F95YAs1FW%2Bympzv9sbmrSz3k5Mz%2FKi6x5uEYCK9S1I%3D&reserved=0<https://www.rbvi.ucsf.edu/trac/ChimeraX/ticket/19460#comment:2>>
ChimeraX <https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.rbvi.ucsf.edu%2Fchimerax%2F&data=05%7C02%7Cshabir.najmudin%40kcl.ac.uk%7C4e49d5c4328b4f5cf98e08de312bc235%7C8370cf1416f34c16b83c724071654356%7C0%7C0%7C639002261184611564%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=wWB%2FhRgaR5EJx17oofqFPYe8CqGwGhq1MGtQMimKUuI%3D&reserved=0<https://www.rbvi.ucsf.edu/chimerax/>>
ChimeraX Issue Tracker

comment:4 by Eric Pettersen, 6 months ago

I hope things work with the newer version. If not, feel free to submit another bug report.

--Eric

comment:5 by shabir.najmudin@…, 6 months ago

Thanks Eric,

all good so far with the latest ChimeraX on my labtop!

Cheers

Shabir
________________________________
From: ChimeraX <ChimeraX-bugs-admin@cgl.ucsf.edu>
Sent: 02 December 2025 18:26
To: pett@cgl.ucsf.edu <pett@cgl.ucsf.edu>; Shabir Najmudin <shabir.najmudin@kcl.ac.uk>
Subject: Re: [ChimeraX] #19460: H-Bonds: More than 2 coplanar positions specified

#19460: H-Bonds: More than 2 coplanar positions specified
-----------------------------------------+----------------------------
          Reporter:  shabir.najmudin@…   |      Owner:  Eric Pettersen
              Type:  defect              |     Status:  closed
          Priority:  normal              |  Milestone:
         Component:  Structure Analysis  |    Version:
        Resolution:  can't reproduce     |   Keywords:
        Blocked By:                      |   Blocking:
Notify when closed:                      |   Platform:  all
           Project:  ChimeraX            |
-----------------------------------------+----------------------------
Comment (by Eric Pettersen):

 I hope things work with the newer version.  If not, feel free to submit
 another bug report.

 --Eric
--
Ticket URL: <https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.rbvi.ucsf.edu%2Ftrac%2FChimeraX%2Fticket%2F19460%23comment%3A4&data=05%7C02%7Cshabir.najmudin%40kcl.ac.uk%7Cec4b19b84fdc46e8480508de31d05d15%7C8370cf1416f34c16b83c724071654356%7C0%7C0%7C639002968152482700%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=2VHkcyE38IiS6GmHCYdX2OOJdFYtplmsYgBpSq64E%2BI%3D&reserved=0<https://www.rbvi.ucsf.edu/trac/ChimeraX/ticket/19460#comment:4>>
ChimeraX <https://eur03.safelinks.protection.outlook.com/?url=https%3A%2F%2Fwww.rbvi.ucsf.edu%2Fchimerax%2F&data=05%7C02%7Cshabir.najmudin%40kcl.ac.uk%7Cec4b19b84fdc46e8480508de31d05d15%7C8370cf1416f34c16b83c724071654356%7C0%7C0%7C639002968152504084%7CUnknown%7CTWFpbGZsb3d8eyJFbXB0eU1hcGkiOnRydWUsIlYiOiIwLjAuMDAwMCIsIlAiOiJXaW4zMiIsIkFOIjoiTWFpbCIsIldUIjoyfQ%3D%3D%7C0%7C%7C%7C&sdata=emHdWrnEye9H5HjcglzWUMWlCQirLcDgeiBy25h4lVg%3D&reserved=0<https://www.rbvi.ucsf.edu/chimerax/>>
ChimeraX Issue Tracker

comment:6 by Eric Pettersen, 6 months ago

Great!

--Eric

Note: See TracTickets for help on using tickets.