#17785 closed defect (fixed)

Combine into existing ID

Reported by: chimerax-bug-report@… Owned by: Eric Pettersen
Priority: normal Milestone:
Component: Structure Editing Version:
Keywords: Cc:
Blocked By: Blocking:
Notify when closed: Platform: all
Project: ChimeraX

Description

The following bug report has been submitted:
Platform:        macOS-15.5-arm64-arm-64bit
ChimeraX Version: 1.9 (2024-12-11 19:11:19 UTC)
Description
Replace this text with list of actions that caused this problem to occur

Log:
UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/_HT-KIF5B[1-560] on Tubulin.cxs"

Log from Fri May 23 18:50:52 2025UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs" format
> session

Log from Fri May 23 18:38:32 2025UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs" format
> session

Log from Fri May 23 17:49:00 2025UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

Log from Fri May 23 16:10:45 2025UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs" format
> session

Log from Fri May 23 15:23:39 2025UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

Log from Wed Mar 12 17:10:07 2025UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs" format session

Log from Wed Mar 12 16:11:25 2025UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin Q2PQA9.1.A on Tubulin.cxs" format session

Log from Wed Mar 12 14:42:57 2025UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin-Tubulin.cxs"

Log from Wed Mar 12 14:08:56 2025UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  

> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin-Tubulin.cxs" format session

Log from Mon Mar 10 18:49:05 2025 Startup Messages  
---  
warning | QCoreApplication::postEvent: Unexpected null receiver  
note | available bundle cache has not been initialized yet  
  
You can double click a model's Name or ID in the model panel to edit those
fields  
UCSF ChimeraX version: 1.9 (2024-12-11)  
© 2016-2024 Regents of the University of California. All rights reserved.  
How to cite UCSF ChimeraX  

> help help:quickstart

> open /Users/nukakola/Downloads/4hna.cif

Summary of feedback from opening /Users/nukakola/Downloads/4hna.cif  
---  
notes | Fetching CCD ADP from https://files.wwpdb.org/pub/pdb/refdata/chem_comp/P/ADP/ADP.cif  
Fetching CCD ALF from
https://files.wwpdb.org/pub/pdb/refdata/chem_comp/F/ALF/ALF.cif  
Fetching CCD GDP from
https://files.wwpdb.org/pub/pdb/refdata/chem_comp/P/GDP/GDP.cif  
Fetching CCD GTP from
https://files.wwpdb.org/pub/pdb/refdata/chem_comp/P/GTP/GTP.cif  
Fetching CCD MG from
https://files.wwpdb.org/pub/pdb/refdata/chem_comp/G/MG/MG.cif  
  
4hna.cif title:  
Kinesin motor domain in the ADP-MG-ALFX state in complex with tubulin and a
DARPIN [more info...]  
  
Chain information for 4hna.cif #1  
---  
Chain | Description | UniProt  
A | Tubulin alpha chain | D0VWZ0_SHEEP 1-451  
B | Tubulin beta chain | D0VWY9_SHEEP 1-455  
D | DESIGNED ANKYRIN REPEAT PROTEIN (DARPIN) D2 |   
K | Kinesin-1 heavy chain | KINH_HUMAN 1-349  
  
Non-standard residues in 4hna.cif #1  
---  
ADP — adenosine-5'-diphosphate  
ALF — tetrafluoroaluminate ion  
GDP — guanosine-5'-diphosphate  
GTP — guanosine-5'-triphosphate  
MG — magnesium ion  
  

> hide atoms

> show atoms

> hide atoms

> show cartoons

> hide cartoons

> show cartoons

> style stick

Changed 10607 atom styles  

> style sphere

Changed 10607 atom styles  

> style ball

Changed 10607 atom styles  

> hide atoms

> show atoms

> style sphere

Changed 10607 atom styles  

> style stick

Changed 10607 atom styles  

> hide cartoons

> style sphere

Changed 10607 atom styles  

> style ball

Changed 10607 atom styles  

> style stick

Changed 10607 atom styles  

> hide atoms

> show cartoons

> select /D

1185 atoms, 1200 bonds, 159 residues, 1 model selected  

> select /K

2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected  

> select sequence 1-10

Nothing selected  

> select /D

1185 atoms, 1200 bonds, 159 residues, 1 model selected  

> coulombic sel

The following heavy (non-hydrogen) atoms are missing, which may result in
inaccurate electrostatics:  
/D SER 12 OG  
/D ASN 169 OXT  

Using Amber 20 recommended default charges and atom types for standard
residues  
Coulombic values for 4hna.cif_D SES surface #1.3: minimum, -19.96, mean -6.63,
maximum 8.31  
To also show corresponding color key, enter the above coulombic command and
add key true  

> rainbow sel

> color bfactor sel

1185 atoms, 159 residues, 1 surfaces, atom bfactor range 42.2 to 180  

> color sel byhetero

> style sel ball

Changed 1185 atom styles  

> style sel sphere

Changed 1185 atom styles  

> style sel stick

Changed 1185 atom styles  

> hide sel atoms

> show sel cartoons

> hide sel cartoons

> hide sel surfaces

> show sel cartoons

> show sel surfaces

> hide sel surfaces

> color sel bychain

> color #1 #919191ff

Cell requested for row 0 is out of bounds for table with 5 rows! Resizing
table model.  

> select add #1

10607 atoms, 10809 bonds, 13 pseudobonds, 1363 residues, 5 models selected  

> select subtract #1

1 model selected  

> select add #1

10607 atoms, 10809 bonds, 13 pseudobonds, 1363 residues, 4 models selected  

> select subtract #1.1

10607 atoms, 10809 bonds, 1 pseudobond, 1363 residues, 4 models selected  

> select subtract #1.2

10607 atoms, 10809 bonds, 1363 residues, 2 models selected  

> select subtract #1.3

9422 atoms, 9609 bonds, 1204 residues, 2 models selected  

> select add #1

10607 atoms, 10809 bonds, 13 pseudobonds, 1363 residues, 4 models selected  

> select subtract #1

1 model selected  

> select add #1.1

12 pseudobonds, 1 model selected  

> select subtract #1.1

Nothing selected  

> select add #1.1

12 pseudobonds, 1 model selected  

> select subtract #1.1

Nothing selected  

> select add #1.1

12 pseudobonds, 1 model selected  

> select subtract #1.1

Nothing selected  

> select add #1.2

1 pseudobond, 2 models selected  

> select subtract #1.2

Nothing selected  

> select add #1.2

1 pseudobond, 2 models selected  

> select subtract #1.2

Nothing selected  

> select add #1.3

1185 atoms, 159 residues, 1 model selected  

> select subtract #1.3

1 model selected  

> select /D

1185 atoms, 1200 bonds, 159 residues, 1 model selected  

> color #1.3 #8efa00ff

> color #1.3 #00f900ff

> color sel bynucleotide

Alignment identifier is 1/D  

> hide #1.3 target m

> close #1.3

> lighting simple

> lighting soft

> lighting full

> lighting simple

> lighting soft

> ui tool show "Selection Inspector"

> select /D

1185 atoms, 1200 bonds, 159 residues, 1 model selected  

> color sel forest green

> select /A

3382 atoms, 3458 bonds, 3 pseudobonds, 432 residues, 3 models selected  

> color (#!1 & sel) lime

> select /B

3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected  

> color (#!1 & sel) #009051ff

> select /A

3382 atoms, 3458 bonds, 3 pseudobonds, 432 residues, 3 models selected  

> color (#!1 & sel) #00f900ff

> color (#!1 & sel) #8efa00ff

> color (#!1 & sel) #d4fb79ff

> color (#!1 & sel) #73fa79ff

> color (#!1 & sel) #fffc79ff

> color (#!1 & sel) #d4fb79ff

> color (#!1 & sel) #73fa79ff

> select /D

1185 atoms, 1200 bonds, 159 residues, 1 model selected  

> color sel #d6d6d6ff

> color sel #ffffffff

> color sel #212121ff

> color sel #424242ff

> color sel #797979ff

> select /K

2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected  

> color (#!1 & sel) #0096ffff

> select /A

3382 atoms, 3458 bonds, 3 pseudobonds, 432 residues, 3 models selected  

> show sel surfaces

> hide sel cartoons

> hide sel atoms

> select /B

3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected  

> show sel surfaces

> hide sel cartoons

> hide sel atoms

> select /D

1185 atoms, 1200 bonds, 159 residues, 1 model selected  

> hide sel cartoons

> hide #!1.2 models

> close #1.2

> select /K:85-92

52 atoms, 51 bonds, 8 residues, 1 model selected  

> color sel red

> save "/Users/nukakola/Desktop/_Analysis Local Copies/Kinesin-Tubulin.cxs"

> select /K

2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected  

> show sel surfaces

> hide sel surfaces

> show sel atoms

> hide sel atoms

> select /K:85-92

52 atoms, 51 bonds, 8 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> show sel surfaces

> color (#!1 & sel) red

> select up

133 atoms, 135 bonds, 18 residues, 2 models selected  

> select up

2593 atoms, 2632 bonds, 333 residues, 2 models selected  

> select up

2628 atoms, 2665 bonds, 338 residues, 2 models selected  

> select up

10607 atoms, 10809 bonds, 1363 residues, 2 models selected  

> select up

10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected  

> select down

10607 atoms, 10809 bonds, 1363 residues, 4 models selected  

> select up

10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected  

> select up

10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected  

> select up

10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected  

> select up

10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected  

> select up

10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected  

> select up

10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected  

> select down

12 pseudobonds, 4 models selected  

> select down

Nothing selected  

> select /K

2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected  

> show sel surfaces

> save "/Users/nukakola/Desktop/_Analysis Local Copies/Kinesin-Tubulin.cxs"

> hide sel surfaces

> ui tool show "Side View"

[Repeated 1 time(s)]

> graphics silhouettes true

> graphics silhouettes false

> graphics silhouettes true

> graphics silhouettes false

> volume style surface

No volumes specified  

> volume style mesh

No volumes specified  

> volume planes z style image imageMode "full region"

No volumes specified  

> ui mousemode right select

> select /A:437@C

1 atom, 1 residue, 1 model selected  
Drag select of 4hna.cif_A SES surface, 306 of 328216 triangles, 4hna.cif_B SES
surface, 822 of 322588 triangles  

> ui mousemode right translate

> ui mousemode right select

> select sequence 1-10

Nothing selected  

> ui tool show "Show Sequence Viewer"

> sequence chain /K

Alignment identifier is 1/K  

> select
> /K:10-15,32-34,38-41,44-47,51-52,79-85,126-138,141-144,154-157,163-166,171-173,192-193,201-202,205-216,222-231,295-302

728 atoms, 731 bonds, 88 residues, 1 model selected  

> select /K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324

1022 atoms, 1024 bonds, 134 residues, 1 model selected  

> select
> /K:10-15,32-34,38-41,44-47,51-52,79-85,126-138,141-144,154-157,163-166,171-173,192-193,201-202,205-216,222-231,295-302

728 atoms, 731 bonds, 88 residues, 1 model selected  

> select /K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324

1022 atoms, 1024 bonds, 134 residues, 1 model selected  

> select /K:11

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select /K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324

1022 atoms, 1024 bonds, 134 residues, 1 model selected  

> select clear

> select
> /K:10-15,32-34,38-41,44-47,51-52,79-85,126-138,141-144,154-157,163-166,171-173,192-193,201-202,205-216,222-231,295-302

728 atoms, 731 bonds, 88 residues, 1 model selected  

> select /K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324

1022 atoms, 1024 bonds, 134 residues, 1 model selected  

> select clear

[Repeated 2 time(s)]

> select /K:337

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select /K:337

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select /K:5-6

14 atoms, 13 bonds, 2 residues, 1 model selected  

> select /K:5-6

14 atoms, 13 bonds, 2 residues, 1 model selected  

> select /K:246:270

14 atoms, 12 bonds, 2 residues, 1 model selected  

> select /K:246-270

177 atoms, 176 bonds, 25 residues, 1 model selected  

> ui tool show "Selection Inspector"

> style sel ball

Changed 177 atom styles  

> style sel sphere

Changed 177 atom styles  

> style sel stick

Changed 177 atom styles  

> show sel atoms

> style sel ball

Changed 177 atom styles  

> style sel sphere

Changed 177 atom styles  

> style sel stick

Changed 177 atom styles  

> style sel ball

Changed 177 atom styles  

> hide sel atoms

> select /K:1

Nothing selected  

> select /K:12

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select /K:2

Nothing selected  

> select /K:1-2

Nothing selected  

> select /K:3

Nothing selected  

> select /K:4

Nothing selected  

> select /K:5

5 atoms, 4 bonds, 1 residue, 1 model selected  

> style sel sphere

Changed 5 atom styles  

> show sel cartoons

> hide sel atoms

> show sel atoms

> style sel ball

Changed 5 atom styles  

> style sel sphere

Changed 5 atom styles  

> style sel stick

Changed 5 atom styles  

> style sel sphere

Changed 5 atom styles  

> style sel ball

Changed 5 atom styles  

> style sel sphere

Changed 5 atom styles  

> color (#!1 & sel) hot pink

> hide sel cartoons

> show sel cartoons

> hide sel cartoons

> show sel atoms

> hide sel atoms

> show sel atoms

> hide sel cartoons

> show sel cartoons

> hide sel cartoons

> lighting simple

> lighting full

> lighting soft

Drag select of 4hna.cif_A SES surface, 22618 of 328216 triangles, 4hna.cif_B
SES surface, 18965 of 322588 triangles  
Drag select of 4hna.cif_A SES surface, 2789 of 328216 triangles, 4hna.cif_B
SES surface, 9239 of 322588 triangles  

> ui mousemode right translate

> ui tool show "Render/Select by Attribute"

> color byattribute a:charge #!1 target s palette
> -0.8188,blue:-0.0056,white:0.8076,red

3 surfaces, atom charge range -0.819 to 0.808  

> select /K

2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected  

> ui tool show "Render/Select by Attribute"

> color byattribute a:charge #!1 target cabs palette
> -0.8188,blue:-0.0056,white:0.8076,red

10607 atoms, 1363 residues, 3 surfaces, atom charge range -0.819 to 0.808  

> show sel surfaces

> hide sel surfaces

> show sel cartoons

> hide sel cartoons

> show sel cartoons

> select /K:5

5 atoms, 4 bonds, 1 residue, 1 model selected  

> hide sel cartoons

> undo

[Repeated 9 time(s)]

> select clear

[Repeated 1 time(s)]

> select /K:102

7 atoms, 7 bonds, 1 residue, 1 model selected  

> select /K:97:105

12 atoms, 10 bonds, 2 residues, 1 model selected  

> select /K:97-105

67 atoms, 68 bonds, 9 residues, 1 model selected  

> select /K:97-106

71 atoms, 72 bonds, 10 residues, 1 model selected  

> select /K:97-105

67 atoms, 68 bonds, 9 residues, 1 model selected  

> color (#!1 & sel) yellow

> select /K:124

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select /K:123-125

25 atoms, 24 bonds, 3 residues, 1 model selected  

> color (#!1 & sel) yellow

> select /K:5-6

14 atoms, 13 bonds, 2 residues, 1 model selected  

> select clear

> select /K:5-16

99 atoms, 99 bonds, 12 residues, 1 model selected  

> select clear

> select /K:5-8

28 atoms, 27 bonds, 4 residues, 1 model selected  

> select /K:5-8

28 atoms, 27 bonds, 4 residues, 1 model selected  

> select clear

> select /K:97-98

13 atoms, 12 bonds, 2 residues, 1 model selected  

> select /K:97-105

67 atoms, 68 bonds, 9 residues, 1 model selected  

> select /K:89

6 atoms, 5 bonds, 1 residue, 1 model selected  

> select /K:86-89

28 atoms, 27 bonds, 4 residues, 1 model selected  

> select /K:139

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select /K:139-140

16 atoms, 15 bonds, 2 residues, 1 model selected  

> select /K:145-146

16 atoms, 15 bonds, 2 residues, 1 model selected  

> select /K:145-150

46 atoms, 45 bonds, 6 residues, 1 model selected  

> select /K:158-159

17 atoms, 16 bonds, 2 residues, 1 model selected  

> select /K:158-162

43 atoms, 42 bonds, 5 residues, 1 model selected  

> select /K:232

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select /K:232-236

32 atoms, 31 bonds, 5 residues, 1 model selected  

> select /K:217

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select /K:217-221

41 atoms, 40 bonds, 5 residues, 1 model selected  

> color (#!1 & sel) yellow

> select /K:219

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select clear

> select /K:221

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select /K:216

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select clear

> open /Users/nukakola/Downloads/Q2PQA9.1.A.pdb

Summary of feedback from opening /Users/nukakola/Downloads/Q2PQA9.1.A.pdb  
---  
warnings | Ignored bad PDB record found on line 2  
REMARK File generated by Swiss-PdbViewer 3.70b19  
  
Ignored bad PDB record found on line 3  
REMARK http://www.expasy.org/spdbv/  
  
Ignored bad PDB record found on line 4469  
SPDBVf  
  
Ignored bad PDB record found on line 4470  
SPDBVa 0 1 2 3 4 5 6 7 8 9  
  
Ignored bad PDB record found on line 4471  
SPDBVa 10 11 12 13 14 15 16 17 18 19  
  
59 messages similar to the above omitted  
Duplicate atom serial number found: 1  
Duplicate atom serial number found: 2  
Duplicate atom serial number found: 3  
Duplicate atom serial number found: 4  
Duplicate atom serial number found: 5  
4459 messages similar to the above omitted  
Ignored bad PDB record found on line 12203  
SPDBVf  
  
Ignored bad PDB record found on line 12204  
SPDBVa 0 1 2 3 4 5 6 7 8 9  
  
Ignored bad PDB record found on line 12205  
SPDBVa 10 11 12 13 14 15 16 17 18 19  
  
Ignored bad PDB record found on line 12206  
SPDBVa 20 21 22 23 24 25 26 27 28 29  
  
Ignored bad PDB record found on line 12207  
SPDBVa 30 31 32 33 34 35 36 37 38 39  
  
94 messages similar to the above omitted  
note | Combining 8 symmetry atoms into LEU /A:4 CD1  
  
Chain information for Q2PQA9.1.A.pdb #2  
---  
Chain | Description  
A | No description available  
  
Computing secondary structure  

> lighting soft

> ui tool show Matchmaker

> lighting full

> lighting soft

> select sequence 1-10

Nothing selected  

> help help:user/findseq.html

> select #2/A:1-560

8908 atoms, 9016 bonds, 1120 residues, 1 model selected  

> select #2/A:1-260

4109 atoms, 4175 bonds, 520 residues, 1 model selected  

> select #2/A:1-300

4709 atoms, 4781 bonds, 600 residues, 1 model selected  

> select #2/A:1-350

5515 atoms, 5599 bonds, 700 residues, 1 model selected  

> select #2/A:1-330

5163 atoms, 5241 bonds, 660 residues, 1 model selected  

> select #2/A:1-340

5329 atoms, 5411 bonds, 680 residues, 1 model selected  

> select #2/A:1-340

5329 atoms, 5411 bonds, 680 residues, 1 model selected  

> select #2/A:1-330

5163 atoms, 5241 bonds, 660 residues, 1 model selected  

> align #2/A:1-330@ca toAtoms #1/K:1-330@ca

Unequal number of atoms to pair, 660 and 326  

> align #2/A:1-330 toAtoms #1/K:1-330

Unequal number of atoms to pair, 5163 and 2551  

> ui tool show Matchmaker

> matchmaker #2 to #1/K pairing bs

Computing secondary structure  
[Repeated 1 time(s)]  Parameters  
---  
Chain pairing | bs  
Alignment algorithm | Needleman-Wunsch  
Similarity matrix | BLOSUM-62  
SS fraction | 0.3  
Gap open (HH/SS/other) | 18/18/6  
Gap extend | 1  
SS matrix |  |  | H | S | O  
---|---|---|---  
H | 6 | -9 | -6  
S |  | 6 | -6  
O |  |  | 4  
Iteration cutoff | 2  
  
Matchmaker 4hna.cif, chain K (#1) with Q2PQA9.1.A.pdb, chain A (#2), sequence
alignment score = 1336.7  
RMSD between 296 pruned atom pairs is 0.661 angstroms; (across all 333 pairs:
2.327)  
  

> select #2/A:416-5000

5575 atoms, 5608 bonds, 693 residues, 1 model selected  

> hide sel cartoons

> select #2/A:1-420

6642 atoms, 6742 bonds, 840 residues, 1 model selected  

> show sel cartoons

> color sel #0096ffff

> color sel #0096fff2

> color sel #0096ffec

> color sel #0096ffdc

> color sel #0096ffd6

> color sel #0096ffd2

> color sel #0096ffcf

> color sel #0096ffcc

> color sel #0096ffcb

> color sel #0096ffc9

> color sel #0096ffc8

[Repeated 1 time(s)]

> color sel #0096ffc7

[Repeated 1 time(s)]

> color sel #0096ffc6

[Repeated 1 time(s)]

> color sel #0096ffc5

> color sel #0096ffc4

[Repeated 2 time(s)]

> color sel #0096ffc3

[Repeated 1 time(s)]

> color sel #0096ffc1

> color sel #0096ffc0

> color sel #0096ffbe

> color sel #0096ffbb

> color sel #0096ffb9

> color sel #0096ffb6

> color sel #0096ffb0

> color sel #0096ffab

> color sel #0096ffa7

> color sel #0096ffa3

> color sel #0096ff9f

> color sel #0096ff9d

> color sel #0096ff9b

> color sel #0096ff99

> color sel #0096ff96

> color sel #0096ff95

> color sel #0096ff93

> color sel #0096ff91

> color sel #0096ff90

> color sel #0096ff8e

> color sel #0096ff8d

> color sel #0096ff8c

> color sel #0096ff8b

> color sel #0096ff8a

> color sel #0096ff88

> color sel #0096ff86

> color sel #0096ff84

> color sel #0096ff83

> color sel #0096ff81

> color sel #0096ff80

> color sel #0096ff76

> color sel #0096ff71

> color sel #0096ff69

> color sel #0096ff64

> color sel #0096ff62

> color sel #0096ff5e

> color sel #0096ff5c

> color sel #0096ff59

> color sel #0096ff56

> color sel #0096ff53

> color sel #0096ff51

> color sel #0096ff4e

> color sel #0096ff4b

> color sel #0096ff48

> color sel #0096ff47

> color sel #0096ff45

> color sel #0096ff44

> color sel #0096ff43

> color sel #0096ff41

> color sel #0096ff3e

> color sel #0096ff3b

> color sel #0096ff38

> color sel #0096ff35

> color sel #0096ff33

> color sel #0096ff31

> color sel #0096ff30

> color sel #0096ff2e

> color sel #0096ff2b

> color sel #0096ff29

> color sel #0096ff28

> color sel #0096ff27

[Repeated 1 time(s)]

> color sel #0096ff25

> color sel #0096ff24

[Repeated 1 time(s)]

> color sel #0096ff23

> color sel #0096ff22

[Repeated 1 time(s)]

> color sel #0096ff21

> color sel #0096ff20

> color sel #0096ff1f

> color sel #0096ff1d

> color sel #0096ff1c

> color sel #0096ff1a

> color sel #0096ff18

> color sel #0096ff16

> color sel #0096ff14

> color sel #0096ff12

> color sel #0096ff10

> color sel #0096ff0d

> color sel #0096ff0b

> color sel #0096ff08

> color sel #0096ff06

> color sel #0096ff03

> color sel #0096ff01

> color sel #0096ff00

> color sel #0096ff0b

> color sel #0096ff12

> color sel #0096ff19

> color sel #0096ff24

> color sel #0096ff29

> color sel #0096ff2f

> color sel #0096ff38

> color sel #0096ff3d

> color sel #0096ff44

> color sel #0096ff49

> color sel #0096ff4c

> color sel #0096ff4d

> color sel #0096ff4e

> color sel #0096ff4f

> color sel #0096ff50

[Repeated 1 time(s)]

> color sel #0096ff51

[Repeated 1 time(s)]

> color sel #0096ff52

> color sel #0096ff53

> color sel #73fdffff

[Repeated 1 time(s)]

> color sel #73fdfffa

> color sel #73fdfff2

> color sel #73fdffeb

> color sel #73fdffe6

> color sel #73fdffe1

> color sel #73fdffdd

> color sel #73fdffd9

> color sel #73fdffd6

> color sel #73fdffd3

> color sel #73fdffd1

> color sel #73fdffcf

> color sel #73fdffcc

> color sel #73fdffcb

> color sel #73fdffc7

> color sel #73fdffc4

> color sel #73fdffc1

> color sel #73fdffbd

> color sel #73fdffb9

> color sel #73fdffb5

> color sel #73fdffb3

> color sel #73fdffb0

> color sel #73fdffae

> color sel #73fdffac

> color sel #73fdffa9

> color sel #73fdffa7

> color sel #73fdffa4

> color sel #73fdffa2

> color sel #73fdffa0

> color sel #73fdff9c

> color sel #73fdff98

> color sel #73fdff93

> color sel #73fdff8f

> color sel #73fdff89

> color sel #73fdff84

> color sel #73fdff81

> color sel #73fdff7c

> color sel #73fdff78

> color sel #73fdff75

> color sel #73fdff71

> color sel #73fdff6e

> color sel #73fdff6b

> color sel #73fdff69

> color sel #73fdff67

> color sel #73fdff66

> color sel #73fdff65

> color sel #73fdff63

> color sel #73fdff61

> color sel #73fdff5f

> color sel #73fdff5d

> color sel #73fdff59

> color sel #73fdff56

> color sel #73fdff54

> color sel #73fdff53

> color sel #73fdff50

> color sel #73fdff4f

> color sel #73fdff4e

> color sel #73fdff4c

> color sel #73fdff4b

> color sel #73fdff4a

> color sel #73fdff49

> color sel #73fdff48

> color sel #73fdff47

> color sel #73fdff46

> color sel #73fdff45

> color sel #73fdff44

> color sel #73fdff43

> color sel #73fdff42

[Repeated 1 time(s)]

> color sel #73fdff40

> color sel #73fdff3f

[Repeated 1 time(s)]

> color sel #73fdff3e

[Repeated 2 time(s)]

> color sel #73fdff3d

[Repeated 1 time(s)]

> color sel #73fdff3c

> color sel #73fdff3b

> color sel #73fdff39

> color sel #73fdff38

> color sel #73fdff35

> color sel #73fdff31

> color sel #73fdff2c

> color sel #73fdff28

> color sel #73fdff25

> color sel #73fdff24

> color sel #73fdff23

> color sel #73fdff22

> color sel #73fdff20

> color sel #73fdff1e

> color sel #73fdff1b

> color sel #73fdff18

> color sel #73fdff16

> color sel #73fdff14

> color sel #73fdff12

> color sel #73fdff11

> color sel #73fdff10

> color sel #73fdff0f

> color sel #73fdff0e

> color sel #73fdff0c

> color sel #73fdff0a

> color sel #73fdff08

> color sel #73fdff07

> color sel #73fdff06

> color sel #73fdff05

> color sel #73fdff02

> color sel #73fdff00

> color sel #73fdff0c

> color sel #73fdff1b

> color sel #73fdff3a

> color sel #73fdff40

> color sel #73fdff42

> color sel #73fdff45

> color sel #73fdff49

> color sel #73fdff53

> color sel #73fdff5b

> color sel #73fdff66

> color sel #73fdff6e

> color sel #73fdff72

> color sel #73fdff75

[Repeated 2 time(s)]

> color sel #73fdff73

> color sel #73fdff6f

> color sel #73fdff6c

> color sel #73fdff68

> color sel #73fdff65

> color sel #73fdff62

> color sel #73fdff5e

> color sel #73fdff5a

> color sel #73fdff55

> color sel #73fdff51

> color sel #73fdff4c

> color sel #73fdff48

> color sel #73fdff44

> color sel #73fdff41

> color sel #73fdff40

[Repeated 4 time(s)]

> color sel #73fdff41

[Repeated 1 time(s)]

> color sel #73fdff42

> color sel #73fdff43

[Repeated 1 time(s)]

> color sel #73fdff44

> color sel #73fdff45

> color sel #73fdff46

> color sel #73fdff47

[Repeated 1 time(s)]

> color sel #73fdff48

[Repeated 2 time(s)]

> color sel #73fdff49

> save "/Users/nukakola/Desktop/_Analysis Local Copies/Kinesin-MT Binding Site
> Structure/Kinesin-Tubulin.cxs"

——— End of log from Mon Mar 10 18:49:05 2025 ———

opened ChimeraX session  

> hide sel cartoons

> select
> #1/K:19-24,57-76,90-96,106-122,175-188,237-242,245-271,276-292,305-324

1022 atoms, 1024 bonds, 134 residues, 1 model selected  

> select #1/k:96-222

1037 atoms, 1056 bonds, 127 residues, 1 model selected  

> color sel deep sky blue

> color sel royal blue

> color sel dodger blue

> select #1/k:273:101

15 atoms, 13 bonds, 2 residues, 1 model selected  

> style sel sphere

Changed 15 atom styles  

> show sel atoms

> style sel stick

Changed 15 atom styles  

> style sel ball

Changed 15 atom styles  

> color sel lime

> select #1/k:28:53

18 atoms, 16 bonds, 2 residues, 1 model selected  

> color sel yellow

> style sel ball

Changed 18 atom styles  

> show sel atoms

> show sel cartoons

> select #1/k:220:74:41

25 atoms, 22 bonds, 3 residues, 1 model selected  

> show sel atoms

> style sel ball

Changed 25 atom styles  

> color sel tomato

> select #1/K:5@CB

1 atom, 1 residue, 1 model selected  

> hide sel atoms

> show sel atoms

> style sel stick

Changed 1 atom style  

> style sel stick

Changed 1 atom style  

> style sel sphere

Changed 1 atom style  

> hide sel cartoons

> show sel cartoons

> select #1/K:5@CA

1 atom, 1 residue, 1 model selected  

> select #1/K:5@CB

1 atom, 1 residue, 1 model selected  

> select #1/K:5@CA

1 atom, 1 residue, 1 model selected  

> select #1/K:5@CB

1 atom, 1 residue, 1 model selected  

> select ~sel & ##selected

10606 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 2 models selected  

> select ~sel & ##selected

1 atom, 1 residue, 1 model selected  

> select ~sel & ##selected

10606 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 2 models selected  

> select ~sel & ##selected

1 atom, 1 residue, 1 model selected  

> select up

5 atoms, 4 bonds, 1 residue, 2 models selected  

> select down

1 atom, 1 residue, 2 models selected  

> select up

5 atoms, 4 bonds, 1 residue, 2 models selected  

> select up

36 atoms, 35 bonds, 5 residues, 2 models selected  

> select up

2593 atoms, 2632 bonds, 333 residues, 2 models selected  

> select down

36 atoms, 35 bonds, 5 residues, 2 models selected  

> select down

5 atoms, 4 bonds, 1 residue, 2 models selected  

> select down

1 atom, 1 residue, 2 models selected  

> select down

1 atom, 1 residue, 2 models selected  

> select up

5 atoms, 4 bonds, 1 residue, 2 models selected  

> hide sel cartoons

> hide sel atoms

> show sel cartoons

> style sel ball

Changed 5 atom styles  

> show sel atoms

> color sel purple

> rename #1 "4hna: KHC + TA/B"

> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin-Tubulin.cxs"

——— End of log from Wed Mar 12 14:08:56 2025 ———

opened ChimeraX session  

> select #1/K:73

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select up

78 atoms, 77 bonds, 10 residues, 2 models selected  

> select up

2593 atoms, 2632 bonds, 333 residues, 2 models selected  

> select up

2628 atoms, 2665 bonds, 338 residues, 2 models selected  

> select up

10607 atoms, 10809 bonds, 1363 residues, 2 models selected  

> select up

10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected  

> select up

10607 atoms, 10809 bonds, 12 pseudobonds, 1363 residues, 5 models selected  

> select down

12 pseudobonds, 4 models selected  

> select down

Nothing selected  

> select #1/K:72

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select up

78 atoms, 77 bonds, 10 residues, 2 models selected  

> select up

2593 atoms, 2632 bonds, 333 residues, 2 models selected  

> hide sel

> hide sel target ca

> show sel target s

> hide sel target s

> select #2/A

12127 atoms, 12262 bonds, 1523 residues, 1 model selected  

> show sel cartoons

> select color dodger blue

Expected an objects specifier or a keyword  

> color dodger blue

> undo

> select ~sel & ##selected

Nothing selected  

> select ~sel & ##selected

Nothing selected  

> color sel dodger blue

> select #2/A:881

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select up

413 atoms, 414 bonds, 50 residues, 1 model selected  

> select up

7670 atoms, 7753 bonds, 963 residues, 1 model selected  

> color sel dodger blue

> color sel crimson

> color sel dodger blue

> color sel red

> color sel dodger blue

> ui tool show "Color Actions"

> color sel dodger blue

> color sel #747474ff

> color sel #747474d2

> color sel #747474d6

> color sel #747474eb

> color sel #747474f4

> color sel #747474fe

> color sel #747474ff

> color sel #744039ff

> color sel dodger blue

> lighting soft

> lighting simple

> lighting full

> lighting soft

> select clear

> select #2/A:443

12 atoms, 10 bonds, 2 residues, 1 model selected  

> select up

2429 atoms, 2435 bonds, 301 residues, 1 model selected  

> select up

12124 atoms, 12262 bonds, 1523 residues, 1 model selected  

> color sel dodger blue

> select clear

> select #2/A:70

14 atoms, 12 bonds, 2 residues, 1 model selected  

> select up

130 atoms, 128 bonds, 16 residues, 1 model selected  

> select up

12124 atoms, 12262 bonds, 1523 residues, 1 model selected  

> select clear

> select #2/A:122

16 atoms, 14 bonds, 2 residues, 1 model selected  

> select clear

> toolshed show

> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin Q2PQA9.1.A on Tubulin.cxs"

——— End of log from Wed Mar 12 14:42:57 2025 ———

opened ChimeraX session  

> delete #2/A:

Missing or invalid "atoms" argument: only initial part "#2/A" of atom
specifier valid  

> delete #2/:.A

Missing or invalid "atoms" argument: only initial part "#2" of atom specifier
valid  

> delete :.A

Missing or invalid "atoms" argument: invalid atoms specifier  

> select #2/A:114

16 atoms, 14 bonds, 2 residues, 1 model selected  

> select up

210 atoms, 214 bonds, 24 residues, 1 model selected  

> select up

12124 atoms, 12262 bonds, 1523 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select #2/A

3 atoms, 1 pseudobond, 2 residues, 2 models selected  

> delete atoms (#!2 & sel)

> delete bonds (#!2 & sel)

> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs"

——— End of log from Wed Mar 12 16:11:25 2025 ———

opened ChimeraX session  

> select /D

1185 atoms, 1200 bonds, 159 residues, 1 model selected  

> delete atoms sel

> delete bonds sel

> select /K

2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected  

> show sel cartoons

> select clear

> select /K:64

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select up

78 atoms, 78 bonds, 10 residues, 2 models selected  

> select up

2593 atoms, 2632 bonds, 333 residues, 2 models selected  

> color sel dodger blue

> select clear

> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/Kinesin on Tubulin Default.cxs"

> open "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/z_Original_Structures/HT-KIF560.cif"

Summary of feedback from opening /Users/nk/Desktop/_Analysis Local
Copies/_Structural Analysis of Kinesin HC and MTs/z_Original_Structures/HT-
KIF560.cif  
---  
warnings | Missing entity information. Treating each chain as a separate entity.  
Atom H is not in the residue template for MET /A:1  
Missing or incomplete sequence information. Inferred polymer connectivity.  
  
  
Chain information for HT-KIF560.cif #2  
---  
Chain | Description  
A | No description available  
  
Color HT-KIF560.cif by residue attribute pLDDT_score  
Computing secondary structure  

> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs"

> align

Missing or invalid "atoms" argument: empty atom specifier  

> select #1/K:128

11 atoms, 11 bonds, 1 residue, 1 model selected  

> select #2/A:768

15 atoms, 14 bonds, 1 residue, 1 model selected  

> align #2/A:1-315ca toAtoms #1/K:1-315@ca

Unequal number of atoms to pair, 0 and 311  

> align #2/A:5-315ca toAtoms #1/K:5-315@ca

Unequal number of atoms to pair, 0 and 311  

> select #1/K:5-315

2434 atoms, 2472 bonds, 311 residues, 1 model selected  

> select #1/K:5-320

2474 atoms, 2513 bonds, 316 residues, 1 model selected  

> select #1/K:324

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select #1/K:5-325

2514 atoms, 2553 bonds, 321 residues, 1 model selected  

> select #2/A:5-325

5068 atoms, 5151 bonds, 321 residues, 1 model selected  

> select sequence gagtgcaacatcaaagtgatgtgt

Nothing selected  

> select sequence ECNIKVMC

125 atoms, 124 bonds, 8 residues, 1 model selected  

> ui tool show "Show Sequence Viewer"

> sequence chain #2/A

Alignment identifier is 2/A  

> select #1/K:321

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select sequence ECNIKVMC

125 atoms, 124 bonds, 8 residues, 1 model selected  

> select #1/K:320

9 atoms, 8 bonds, 1 residue, 1 model selected  

> ui tool show "Show Sequence Viewer"

> sequence chain #1/K

Alignment identifier is 1/K  

> select
> #2/A:45-48,52-54,81-94,106-118,120-122,138-140,143-152,155-164,167-176,183-193,196-207,216-231,249-258,274-277,279-292,294-296,301-305,330-335,368-375,377-384,401-405,417-431,486-502,510-512,548-550,555-579,587-589,591-595,597-599,616-634,647-679,686-688,692-699,725-868

7368 atoms, 7399 bonds, 453 residues, 1 model selected  

> select clear

> align #2/A:320-634@ca toAtoms #1/K:10-324@ca

RMSD between 315 atom pairs is 2.178 angstroms  

> select #1/K

2628 atoms, 2665 bonds, 7 pseudobonds, 338 residues, 2 models selected  

> hide sel cartoons

> select sequence EPTTEDLYFQSDN

198 atoms, 200 bonds, 13 residues, 1 model selected  

> color sel yellow

> select A:1-297

Expected an objects specifier or a keyword  

> select /A:1-297

6948 atoms, 7075 bonds, 587 residues, 2 models selected  

> color sel hot pink

> undo

> select #2/A:1-297

4696 atoms, 4775 bonds, 297 residues, 1 model selected  

> color sel salmon

> color sel indian red

> color sel coral

> color sel indian red

> color sel tomato

> color sel orange red

> color sel red

> color sel crimson

> color sel dark red

> color sel maroon

> color sel fire brick

> color sel crimson

> select clear

> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs"

> select #1/b:

Expected an objects specifier or a keyword  

> select #1/B:

Expected an objects specifier or a keyword  

> select #1/B

3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected  

> hide sel surfaces

> turn z 30 center #2/A:646@ca atoms #2/A:647-

Invalid "atoms" argument: only initial part "#2/A:647" of atom specifier valid  

> turn z 30 center #2/A:646@ca atoms #2/A:647

[Repeated 2 time(s)]

> undo

[Repeated 1 time(s)]

> turn z -30 center #2/A:646@ca atoms #2/A:647

[Repeated 3 time(s)]

> turn z 30 center #2/A:646@ca atoms #2/A:647

> turn z 30 center #2/A:646@ca atoms #2/A:5000

[Repeated 1 time(s)]

> select clear

[Repeated 1 time(s)]

> turn z 30 center #2/A:646@ca atoms #2/A:870

> turn z -30 center #2/A:646@ca atoms #2/A:870

> turn z -30 center #2/A:646@ca atoms #2/A:647-870

[Repeated 3 time(s)]

> turn z 30 center #2/A:646@ca atoms #2/A:647-870

[Repeated 3 time(s)]

> select #1/A

3382 atoms, 3458 bonds, 2 pseudobonds, 432 residues, 2 models selected  

> select #1/B

3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected  

> show sel surfaces

> select clear

> select #2/A:646

14 atoms, 13 bonds, 1 residue, 1 model selected  

> turn z 30 center #2/A:646@ca atoms #2/A:647-870

[Repeated 7 time(s)]

> select clear

> select #2/A:717

19 atoms, 18 bonds, 1 residue, 1 model selected  

> turn z 30 center #2/A:717@ca atoms #2/A:718-870

[Repeated 3 time(s)]

> turn z 330 center #2/A:717@ca atoms #2/A:718-870

> turn z -330 center #2/A:717@ca atoms #2/A:718-870

> turn z -30 center #2/A:717@ca atoms #2/A:718-870

[Repeated 7 time(s)]

> save "/Users/nk/Desktop/_Analysis Local Copies/_Structural Analysis of
> Kinesin HC and MTs/HT-KIF560 on Tubulin.cxs"

[Repeated 1 time(s)]

——— End of log from Wed Mar 12 17:10:07 2025 ———

opened ChimeraX session  

> select #1/A:289@N

1 atom, 1 residue, 1 model selected  

> select up

5 atoms, 4 bonds, 1 residue, 2 models selected  

> select up

72 atoms, 72 bonds, 10 residues, 2 models selected  

> select up

3061 atoms, 3130 bonds, 392 residues, 2 models selected  

> select up

3127 atoms, 3197 bonds, 401 residues, 2 models selected  

> select up

3349 atoms, 3424 bonds, 430 residues, 2 models selected  

> select up

3382 atoms, 3458 bonds, 432 residues, 2 models selected  

> select up

9422 atoms, 9609 bonds, 1204 residues, 2 models selected  

> select up

9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected  

> select up

9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected  

> select down

12 pseudobonds, 4 models selected  

> select up

9320 atoms, 12 pseudobonds, 1194 residues, 5 models selected  

> select down

12 pseudobonds, 1 model selected  

> ui tool show Toolbar

> hide surfaces

> show surfaces

> undo

[Repeated 9 time(s)]

> redo

[Repeated 9 time(s)]

> undo

[Repeated 1 time(s)]

> redo

[Repeated 2 time(s)]No redo action is available  

> select #2/A:342@HD2

1 atom, 1 residue, 1 model selected  

> select up

22 atoms, 21 bonds, 1 residue, 2 models selected  

> select up

59 atoms, 59 bonds, 3 residues, 2 models selected  

> select up

13791 atoms, 13929 bonds, 870 residues, 2 models selected  

> select up

13791 atoms, 13929 bonds, 870 residues, 2 models selected  

> select up

23213 atoms, 23538 bonds, 2074 residues, 3 models selected  

> select down

13791 atoms, 13929 bonds, 870 residues, 5 models selected  

> hide sel surfaces

> select #1/K:40@CG2

1 atom, 1 residue, 1 model selected  

> select up

7 atoms, 6 bonds, 1 residue, 2 models selected  

> select up

29 atoms, 28 bonds, 4 residues, 2 models selected  

> select up

2593 atoms, 2632 bonds, 333 residues, 2 models selected  

> hide sel surfaces

> select #1/A:348@CA

1 atom, 1 residue, 1 model selected  

> hide #!2 models

> show #!2 models

> hide #!1 models

> show #!1 models

> hide #!1 models

> show #!1 models

> hide #1.1 models

> hide #1.2 models

> select subtract #1.3

1 model selected  

> select add #1.3

3349 atoms, 430 residues, 1 model selected  

> hide #1.3 models

> show #1.3 models

> hide #1.4 models

> show #1.4 models

> hide #2.1 models

> show #2.1 models

> hide #!2 models

> show #!2 models

> select #1.4/A

Nothing selected  

> select #1.4/A:

Expected an objects specifier or a keyword  

> select #1.4/A:

Expected an objects specifier or a keyword  

> select #1/A:1-20

142 atoms, 142 bonds, 20 residues, 1 model selected  

> select #1/A:2@NE

1 atom, 1 residue, 1 model selected  

> select up

11 atoms, 10 bonds, 1 residue, 2 models selected  

> select up

28 atoms, 27 bonds, 3 residues, 2 models selected  

> select up

288 atoms, 294 bonds, 38 residues, 2 models selected  

> select up

293 atoms, 298 bonds, 39 residues, 2 models selected  

> select up

3349 atoms, 3424 bonds, 430 residues, 2 models selected  

> select up

3382 atoms, 3458 bonds, 432 residues, 2 models selected  

> select up

9422 atoms, 9609 bonds, 1204 residues, 2 models selected  

> select down

3382 atoms, 3458 bonds, 432 residues, 4 models selected  

> select down

3349 atoms, 3424 bonds, 430 residues, 2 models selected  

> select clear

> select add #1.3

3349 atoms, 430 residues, 1 model selected  

> hide sel surfaces

> show sel cartoons

> open
> /Users/nukakola/Downloads/fold_megfp_alpha_tubulin/fold_megfp_alpha_tubulin_model_0.cif

Chain information for fold_megfp_alpha_tubulin_model_0.cif #3  
---  
Chain | Description  
A | .  
  
Computing secondary structure  

> select #3/A:681

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select #3/A:681

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select #3/A:292

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select #1/A:315

6 atoms, 5 bonds, 1 residue, 1 model selected  

> select #1/B:342@CE2

1 atom, 1 residue, 1 model selected  

> select clear

> select #1/A:435

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select #1/A:29

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select clear

> select #1/A:29

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select #1/A:81

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select #1/A:435

7 atoms, 6 bonds, 1 residue, 1 model selected  

> align #3/A:249-261@ca toAtoms #1/A:3-435@ca

Unequal number of atoms to pair, 13 and 426  

> select clear

> select #1/A:435

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select up

179 atoms, 180 bonds, 22 residues, 2 models selected  

> select up

3061 atoms, 3130 bonds, 392 residues, 2 models selected  

> select ~sel & ##selected

6361 atoms, 6479 bonds, 12 pseudobonds, 812 residues, 2 models selected  

> select ~sel & ##selected

3061 atoms, 3130 bonds, 392 residues, 1 model selected  

> select ~sel & ##selected

6361 atoms, 6479 bonds, 12 pseudobonds, 812 residues, 2 models selected  

> select ~sel & ##selected

3061 atoms, 3130 bonds, 392 residues, 1 model selected  

> select ~sel & ##selected

6361 atoms, 6479 bonds, 12 pseudobonds, 812 residues, 2 models selected  

> align #3/A:291-681@ca toAtoms #1/A:45-435@ca

Unequal number of atoms to pair, 391 and 390  

> align #3/A:292-681@ca toAtoms #1/A:45-435@ca

RMSD between 390 atom pairs is 3.899 angstroms  

> align #3/A:291-680@ca toAtoms #1/A:45-435@ca

RMSD between 390 atom pairs is 1.166 angstroms  

> hide #3 models

> select subtract #1.4

2983 atoms, 3027 bonds, 12 pseudobonds, 381 residues, 5 models selected  

> select subtract #1.3

2695 atoms, 2733 bonds, 12 pseudobonds, 343 residues, 4 models selected  

> select subtract #1.2

102 atoms, 101 bonds, 10 pseudobonds, 10 residues, 3 models selected  

> select add #1.1

102 atoms, 101 bonds, 12 pseudobonds, 10 residues, 2 models selected  

> show #1.1 models

> select subtract #1.1

102 atoms, 101 bonds, 10 residues, 1 model selected  

> select add #1.1

102 atoms, 101 bonds, 12 pseudobonds, 10 residues, 2 models selected  

> hide #!1 models

> hide #1.3 models

> hide #1.4 models

> hide #!2 models

> hide #2.1 models

> select subtract #1.1

102 atoms, 101 bonds, 10 residues, 1 model selected  

> select add #1.1

102 atoms, 101 bonds, 12 pseudobonds, 10 residues, 2 models selected  

> hide #1.1 models

> show #1.1 models

> hide #!1 models

> show #!1 models

> show #1.3 models

> hide #!1 models

> hide #1.3 models

> show #1.3 models

> hide #1.3 models

> hide #!1 models

> select add #1.2

2695 atoms, 101 bonds, 12 pseudobonds, 343 residues, 2 models selected  

> show #1.2 models

> hide #!1 models

> hide #1.2 models

> hide #1.1 models

> show #1.3 models

> select subtract #1.1

2695 atoms, 101 bonds, 343 residues, 2 models selected  

> select subtract #1.2

102 atoms, 101 bonds, 10 residues, 2 models selected  

> select add #1.3

3451 atoms, 101 bonds, 440 residues, 1 model selected  

> show sel surfaces

> hide sel surfaces

> show sel cartoons

> hide sel cartoons

> show sel atoms

> hide sel atoms

> show sel atoms

> select add #1.1

3451 atoms, 101 bonds, 12 pseudobonds, 440 residues, 3 models selected  

> show #1.4 models

> hide #1.4 models

> select subtract #1.1

3451 atoms, 101 bonds, 440 residues, 2 models selected  

> select subtract #1.3

102 atoms, 101 bonds, 10 residues, 2 models selected  

> select add #1.2

2695 atoms, 101 bonds, 343 residues, 1 model selected  

> select add #1.1

2695 atoms, 101 bonds, 12 pseudobonds, 343 residues, 3 models selected  

> hide sel atoms

> show sel atoms

> select subtract #1.1

2695 atoms, 101 bonds, 343 residues, 2 models selected  

> select add #1.1

2695 atoms, 101 bonds, 12 pseudobonds, 343 residues, 3 models selected  

> select subtract #1.2

102 atoms, 101 bonds, 10 pseudobonds, 10 residues, 3 models selected  

> select add #1.2

2695 atoms, 101 bonds, 10 pseudobonds, 343 residues, 2 models selected  

> select subtract #1.2

102 atoms, 101 bonds, 10 pseudobonds, 10 residues, 3 models selected  

> rename #1.1 "ADP and GTP"

> rename #1.1 "1xADP and 2xGDP"

> show #!2 models

> hide #!2 models

> show #!2 models

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

> rename #1.2 "Kinesin from structure (hide)"

> rename #2.1 "HT-KIF560 from AF"

> rename #1.3 alpha-Tub

> rename #1.4 beta-Tub

> show #1.2 models

> select add #1.2

2695 atoms, 101 bonds, 10 pseudobonds, 343 residues, 2 models selected  

> select add #1.1

2695 atoms, 101 bonds, 12 pseudobonds, 343 residues, 3 models selected  

> hide #1.2 models

> select clear

> show #1.2 models

> hide #!1 models

> show #!1 models

> select add #1.2

2593 atoms, 333 residues, 1 model selected  

> hide #1.2 models

> hide sel cartoons

> hide sel surfaces

> hide sel atoms

> hide sel cartoons

> select add #1.3

5942 atoms, 763 residues, 2 models selected  

> select subtract #1.2

3349 atoms, 430 residues, 3 models selected  

> select add #1.4

6727 atoms, 861 residues, 2 models selected  

> show #1.4 models

> hide sel cartoons

> show sel surfaces

> hide sel cartoons

> hide sel atoms

> show #1.2 models

> select add #1.2

9320 atoms, 1194 residues, 3 models selected  

> select subtract #1.3

5971 atoms, 764 residues, 4 models selected  

> select subtract #1.4

2593 atoms, 333 residues, 3 models selected  

> show sel cartoons

> hide #!2 models

> select add #1.1

2593 atoms, 12 pseudobonds, 333 residues, 3 models selected  

> select subtract #1.2

10 pseudobonds, 2 models selected  

> select #1/K:84

12 atoms, 12 bonds, 1 residue, 1 model selected  

> select up

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

27 atoms, 29 bonds, 1 residue, 1 model selected  

> color #1.1 #ff9300ff models

> toolshed show

> view #1.1 clip false

No displayed objects specified.  

> ui tool show "Color Actions"

> color sel orange

> color sel orange target acspfl

> select up

2628 atoms, 2665 bonds, 338 residues, 1 model selected  

> select down

27 atoms, 29 bonds, 1 residue, 2 models selected  

> select down

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

27 atoms, 29 bonds, 1 residue, 1 model selected  

> select up

2628 atoms, 2665 bonds, 338 residues, 1 model selected  

> select down

27 atoms, 29 bonds, 1 residue, 2 models selected  

> select #1/K:502@O

1 atom, 1 residue, 1 model selected  

> select up

2628 atoms, 2665 bonds, 338 residues, 1 model selected  

> select up

9422 atoms, 9609 bonds, 1204 residues, 2 models selected  

> select up

9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected  

> select down

9422 atoms, 9609 bonds, 1204 residues, 4 models selected  

> select down

2628 atoms, 2665 bonds, 338 residues, 4 models selected  

> select subtract #1.2

35 atoms, 33 bonds, 5 residues, 2 models selected  

> color sel orange target acspfl

> select clear

[Repeated 1 time(s)]

> select up

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select up

3412 atoms, 3486 bonds, 434 residues, 1 model selected  

> select down

5 atoms, 4 bonds, 1 residue, 2 models selected  

> select up

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

28 atoms, 30 bonds, 1 residue, 1 model selected  

> select up

3412 atoms, 3486 bonds, 434 residues, 1 model selected  

> select down

28 atoms, 30 bonds, 1 residue, 2 models selected  

> select clear

> select add #1.3

3349 atoms, 430 residues, 1 model selected  

> select add #1.4

6727 atoms, 861 residues, 2 models selected  

> hide sel surfaces

Drag select of 34 atoms, 34 bonds  
Drag select of 33 atoms, 34 bonds  

> color sel red target acspfl

Drag select of 34 atoms, 34 bonds  

> color sel red target acspfl

Cell requested for row 5 is out of bounds for table with 8 rows! Resizing
table model.  

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> hide #!2 models

> show #!2 models

> select clear

> select add #1.4

3378 atoms, 431 residues, 1 model selected  

> select add #1.3

6727 atoms, 861 residues, 2 models selected  

> show sel surfaces

> select clear

> rename #1.2 "K: Kinesin from structure (hide)"

> select #1.2

2593 atoms, 333 residues, 1 model selected  

> select #1.2:1-20

Nothing selected  

> select #1.2:50-100

Nothing selected  

> select #1.2:50-100

Nothing selected  

> hide #!2 models

> select #1/K:39

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select #1.2/K:50-100

Nothing selected  

> select #1/K:50-100

397 atoms, 403 bonds, 51 residues, 1 model selected  

> rename #1.3 "A: alpha-Tub"

> rename #1.4 "B: beta-Tub"

> select up

452 atoms, 460 bonds, 58 residues, 2 models selected  

> select up

2593 atoms, 2632 bonds, 333 residues, 2 models selected  

> hide sel cartoons

> show #!2 models

> hide #1.4 models

> show #1.4 models

> hide #1.3 models

> show #1.3 models

> hide #1.3 models

> show #1.3 models

> hide #1.3 models

> show #1.3 models

> hide #1.4 models

> show #1.4 models

> hide #1.4 models

> show #1.4 models

> hide #1.4 models

> show #1.4 models

> hide #!1 models

> show #!1 models

> hide #!1 models

> show #!1 models

> hide #!1 models

> show #!1 models

> show #1.1 models

> hide #!1 models

> show #!1 models

> hide #1.1 models

> show #1.1 models

> select add #1.1

2593 atoms, 2632 bonds, 12 pseudobonds, 333 residues, 3 models selected  

> select subtract #1.2

10 pseudobonds, 2 models selected  

> select add #1.1

12 pseudobonds, 1 model selected  

> select subtract #1.1

Nothing selected  

> show #3 models

> select add #1.3

3349 atoms, 430 residues, 1 model selected  

> hide sel surfaces

> show sel cartoons

> hide #1.3 models

> show #1.3 models

> hide #1.4 models

> show #1.4 models

> hide #1.3 models

> show #1.3 models

> hide #1.3 models

> select clear

> show #1.3 models

> hide #1.3 models

> hide #1.3 ribbons

> hide #1.3 cartoons

> show #1.3 models

> select ~sel & ##selected

Nothing selected  

> select ~sel & ##selected

Nothing selected  

> hide #1.4

> hide #1.3

> show #1.4

> hide #1.3 ribbons

> hide #1.3 cartoons

> hide #1.3

> select #1.3

3349 atoms, 430 residues, 1 model selected  

> hide selection

Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models',
'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword  

> selection hide

Unknown command: selection hide  

> hide

> show

> undo

[Repeated 2 time(s)]

> select add #1.3

3349 atoms, 430 residues, 1 model selected  

> hide sel cartoons

> show sel surfaces

> ui tool show "Show Sequence Viewer"

> sequence chain #1/A

Alignment identifier is 1/A  

> ui tool show "Show Sequence Viewer"

Window position QRect(1985,916 575x191) outside any known screen, using
primary screen  

> sequence chain #3/A

Alignment identifier is 3/A  

> select #1/A:2-437

3341 atoms, 3416 bonds, 429 residues, 1 model selected  

> align #3/A:291:682@ca toAtoms #1/A:46-437@ca

Unequal number of atoms to pair, 9 and 392  

> align #3/A:291-682@ca toAtoms #1/A:46-437@ca

RMSD between 392 atom pairs is 1.173 angstroms  

> select clear

> rename #3 "megfp_alpha_tubulin_model_0 from AF"

> show #2.1 models

> hide #2.1 models

> hide #!2 models

> show #!2 models

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

> select #1/A:2-3

20 atoms, 19 bonds, 2 residues, 1 model selected  

> select #1/A:2-15

103 atoms, 103 bonds, 14 residues, 1 model selected  

> select sequence RECISIHV

130 atoms, 130 bonds, 16 residues, 2 models selected  

> select #1/A:1-246

1867 atoms, 1905 bonds, 239 residues, 1 model selected  

> select #3/A:1-246

1952 atoms, 1995 bonds, 246 residues, 1 model selected  

> color sel lime target acspfl

> select #1/A

3382 atoms, 3458 bonds, 2 pseudobonds, 432 residues, 2 models selected  

> color sel light gray target acspfl

> select #1/B

3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected  

> color sel dark gray target acspfl

> color sel dim gray target acspfl

> color sel gray target acspfl

> select clear

> select #1/B:341@OG

1 atom, 1 residue, 1 model selected  

> select up

6 atoms, 5 bonds, 1 residue, 2 models selected  

> select #1/B

3412 atoms, 3486 bonds, 3 pseudobonds, 434 residues, 2 models selected  

> color sel dim gray target acspfl

> select clear

> select up

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select up

3412 atoms, 3486 bonds, 434 residues, 1 model selected  

> select down

5 atoms, 4 bonds, 1 residue, 2 models selected  

> select #1/B:69@OD2

1 atom, 1 residue, 1 model selected  

> select #1/B:502@MG

1 atom, 1 residue, 1 model selected  

> select up

3412 atoms, 3486 bonds, 434 residues, 1 model selected  

> select down

1 atom, 1 residue, 2 models selected  

> select down

1 atom, 1 residue, 1 model selected  

> select up

3412 atoms, 3486 bonds, 434 residues, 1 model selected  

> select up

9422 atoms, 9609 bonds, 1204 residues, 2 models selected  

> select up

9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected  

> select up

9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 5 models selected  

> select up

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select up

3412 atoms, 3486 bonds, 434 residues, 1 model selected  

> select up

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

28 atoms, 30 bonds, 1 residue, 1 model selected  

> color sel red target acspfl

> select up

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

5 atoms, 4 bonds, 1 residue, 1 model selected  

> color sel red target acspfl

> select clear

> select #3/A:247-696

3517 atoms, 3596 bonds, 450 residues, 1 model selected  

> color sel light gray target acspfl

> split #3 atoms :1-246 atoms :247-696

Split megfp_alpha_tubulin_model_0 from AF (#3) into 2 models  
Chain information for megfp_alpha_tubulin_model_0 from AF 1 #3.1  
---  
Chain | Description  
A | No description available  
  
Chain information for megfp_alpha_tubulin_model_0 from AF 2 #3.2  
---  
Chain | Description  
A | No description available  
  

> hide #1.3 models

> hide #3.2 models

> show #3.2 models

> hide #3.2 models

> show #3.2 models

> hide #3.1 models

> show #3.1 models

> undo

> redo

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

——— End of log from Fri May 23 15:23:39 2025 ———

opened ChimeraX session  

> select #1/B:345@CB

1 atom, 1 residue, 1 model selected  

> select #3/B:681-700

Nothing selected  

> select #3.1/A:681-700

Nothing selected  

> select #3.1:681-700

Nothing selected  

> select #3.2/A:681

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select #3.1/A:681-700

Nothing selected  

> select #3.1/A:681-696

Nothing selected  

> select #3.2/A:681

4 atoms, 3 bonds, 1 residue, 1 model selected  

> select up

174 atoms, 175 bonds, 22 residues, 1 model selected  

> select #3.2/A:682

7 atoms, 6 bonds, 1 residue, 1 model selected  

> select up

116 atoms, 116 bonds, 15 residues, 1 model selected  

> color sel magenta target acspfl

> select clear

> rename #3.1 mEGFP

> rename #3.2 alpha-Tubulin

> close #2.1

> hide #2 models

> show #2 models

> hide #3.1 models

> show #3.1 models

> hide #3.2 models

> show #3.2 models

> show #1.3 models

> hide #3.2 models

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

> select clear

> select #2/A:311

17 atoms, 16 bonds, 1 residue, 1 model selected  

> select #1/K:311-644

232 atoms, 230 bonds, 5 pseudobonds, 32 residues, 2 models selected  

> select #2/A:311-644

5203 atoms, 5242 bonds, 334 residues, 1 model selected  

> name motor_doman sel

> select motor_domain

Expected an objects specifier or a keyword  

> color motor_domain red

Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero',
'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms',
'fromcartoons', 'fromribbons', or 'random' or a keyword  

> color motor_domain bychain red

Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero',
'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms',
'fromcartoons', 'fromribbons', or 'random' or a keyword  

> color bychain motor_domain red

Expected a collection of one of 'All', 'atoms', 'bonds', 'cartoons', 'labels',
'models', 'pseudobonds', 'ribbons', 'rings', or 'surfaces' or a keyword  

> color bychain All motor_domain red

Expected ',' or a keyword  

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

——— End of log from Fri May 23 16:10:45 2025 ———

opened ChimeraX session  

> select #2/A:295-310

235 atoms, 237 bonds, 16 residues, 1 model selected  

> select #2/A:297-310

205 atoms, 207 bonds, 14 residues, 1 model selected  

> select #2/A:298-310

198 atoms, 200 bonds, 13 residues, 1 model selected  

> color sel white target acspfl

> rename #2 HT-KIF5B[1-560]

> select add #1.2

2791 atoms, 200 bonds, 346 residues, 2 models selected  

> select subtract #1.2

198 atoms, 200 bonds, 13 residues, 2 models selected  

> hide #1.2 models

> show #1.2 models

> select add #1.2

2791 atoms, 200 bonds, 346 residues, 2 models selected  

> show sel cartoons

> hide sel cartoons

> show sel cartoons

> hide #1.2 models

> show #1.2 models

> hide #!1 models

> show #!1 models

> select subtract #1.2

198 atoms, 200 bonds, 13 residues, 2 models selected  

> hide #1.2 models

> show #1.2 models

> hide #1.1 models

> show #1.1 models

> hide #1.3 models

> show #1.3 models

> hide #1.2 models

> show #1.2 models

> select add #1.2

2791 atoms, 200 bonds, 346 residues, 2 models selected  

> hide sel surfaces

> hide sel cartoons

> hide sel atoms

> show sel cartoons

> show sel surfaces

> hide #1.2 models

> hide #1.1 models

> show #1.2 models

> hide #1.2 models

> show #1.2 models

> hide #1.2 models

> hide #!2 models

> show #1.2 models

> hide #1.2 models

> hide #1.4 models

> show #1.4 models

> hide #1.3 models

> show #3.2 models

> hide #3.2 models

> show #3.2 models

> show #1.3 models

> hide #1.3 models

> show #1.2 models

> hide #1.2 models

> select subtract #1.2

198 atoms, 200 bonds, 13 residues, 3 models selected  

> select add #2

13791 atoms, 13929 bonds, 870 residues, 2 models selected  

> select subtract #2

1 model selected  

> show #!2 models

> show #1.2 models

> select add #1.2

2593 atoms, 333 residues, 1 model selected  

> hide #1.2 models

> hide sel cartoons

> hide sel surfaces

> show #1.2 models

> hide #1.2 models

> select subtract #1.2

1 model selected  

> select #2/A:307@O

1 atom, 1 residue, 1 model selected  

> select up

17 atoms, 16 bonds, 1 residue, 2 models selected  

> select up

132 atoms, 132 bonds, 9 residues, 2 models selected  

> select up

13791 atoms, 13929 bonds, 870 residues, 2 models selected  

> hide sel surfaces

> select clear

> hide #3.2 models

> show #1.3 models

> show #3.2 models

> hide #3.2 models

> show #3.2 models

> hide #3.2 models

> show #3.2 models

> hide #3.2 models

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

> hide #!1 models

Cell requested for row 0 is out of bounds for table with 10 rows! Resizing
table model.  

Cell requested for row 2 is out of bounds for table with 9 rows! Resizing
table model.  

Cell requested for row 2 is out of bounds for table with 5 rows! Resizing
table model.  

> hide #!3 models

> select #2/A:298-310

198 atoms, 200 bonds, 13 residues, 1 model selected  

> select #2/A:311-464

2451 atoms, 2474 bonds, 154 residues, 1 model selected  

> select #2/A:311-564

3991 atoms, 4024 bonds, 254 residues, 1 model selected  

> select #2/A:311-644

5203 atoms, 5242 bonds, 334 residues, 1 model selected  

> select #2/A:645-675

565 atoms, 569 bonds, 31 residues, 1 model selected  

> select #2/A:645-678

627 atoms, 633 bonds, 34 residues, 1 model selected  

> select #2/A:645-680

665 atoms, 671 bonds, 36 residues, 1 model selected  

> color sel yellow target acspfl

> select #2/A:311-644

5203 atoms, 5242 bonds, 334 residues, 1 model selected  

> color (#!2 & sel) #73ffffff

> color (#!2 & sel) #7370ffff

> color (#!2 & sel) #7370bbff

> select clear

> select #2/A:681-900

3029 atoms, 3037 bonds, 190 residues, 1 model selected  

> select #2/A:681-870

3029 atoms, 3037 bonds, 190 residues, 1 model selected  

> select #2/A:681-869

3006 atoms, 3014 bonds, 189 residues, 1 model selected  

> select #2/A:681-870

3029 atoms, 3037 bonds, 190 residues, 1 model selected  

> color sel gray target acspfl

> select clear

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

> select
> #1/A:10-29,47-51,72-81,88-90,102-108,110-128,143-162,182-198,206-218,223-244,251-260,287-301,306-310,324-338,384-400,404-410,414-435

1798 atoms, 1819 bonds, 227 residues, 1 model selected  

> ui tool show "Show Sequence Viewer"

> sequence chain #2/A

Alignment identifier is 2/A  

> select
> #2/A:13-17,20-27,34-38,60-64,100-105,123-129,236-240,262-266,315-318,320-325,342-344,348-351,354-357,360-362,389-394,436-448,451-454,464-467,473-476,515-526,532-541,605-612,636-639

2289 atoms, 2296 bonds, 135 residues, 1 model selected  

> select
> #2/A:45-48,52-54,81-94,106-118,120-122,138-140,143-152,155-164,167-176,183-193,196-207,216-231,249-258,274-277,279-292,294-296,301-305,330-335,368-375,377-384,401-405,417-431,486-502,510-512,548-550,555-579,587-589,591-595,597-599,616-634,647-679,686-688,692-699,725-868

7368 atoms, 7399 bonds, 453 residues, 1 model selected  

> select
> #2/A:13-17,20-27,34-38,60-64,100-105,123-129,236-240,262-266,315-318,320-325,342-344,348-351,354-357,360-362,389-394,436-448,451-454,464-467,473-476,515-526,532-541,605-612,636-639

2289 atoms, 2296 bonds, 135 residues, 1 model selected  

> select
> #2/A:45-48,52-54,81-94,106-118,120-122,138-140,143-152,155-164,167-176,183-193,196-207,216-231,249-258,274-277,279-292,294-296,301-305,330-335,368-375,377-384,401-405,417-431,486-502,510-512,548-550,555-579,587-589,591-595,597-599,616-634,647-679,686-688,692-699,725-868

7368 atoms, 7399 bonds, 453 residues, 1 model selected  

> select clear

> select #2/A:645-900

3694 atoms, 3709 bonds, 226 residues, 1 model selected  

> hide #2/A:645-900

> hide ribbons #2/A:645-900

Expected ',' or a keyword  

> hide cartoons #2/A:645-900

Expected ',' or a keyword  

> hide sel cartoons

> select #2/A:1-310

4894 atoms, 4976 bonds, 310 residues, 1 model selected  

> hide sel cartoons

> select sequence RILQNNLQEVQKLLDYKDG

Nothing selected  

> select sequnce RILQNNLQEVQKLL

Expected an objects specifier or a keyword  

> select sequence RILQNNLQEVQKLL

Nothing selected  

> select sequence QNNLQEVQKLL

Nothing selected  

> select sequence QNNLQEV

Nothing selected  

> select sequence LQEV

Nothing selected  

> select sequence LQ

265 atoms, 255 bonds, 20 residues, 3 models selected  

> select #2/A:611-631

312 atoms, 314 bonds, 21 residues, 1 model selected  

> select #2/A:631-650

326 atoms, 327 bonds, 20 residues, 1 model selected  

> color sel cyan target acspfl

> select #2/A

13791 atoms, 13929 bonds, 870 residues, 1 model selected  

> show sel

> undo

> show sel cartoons

> select clear

> select #2/A:611-631

312 atoms, 314 bonds, 21 residues, 1 model selected  

> select #2/A:631-650

326 atoms, 327 bonds, 20 residues, 1 model selected  

> color sel yellow target acspfl

> select ~sel & ##selected

13465 atoms, 13602 bonds, 850 residues, 1 model selected  

> select ~sel & ##selected

326 atoms, 327 bonds, 20 residues, 1 model selected  

> select ~sel & ##selected

13465 atoms, 13602 bonds, 850 residues, 1 model selected  

> select ~sel & ##selected

326 atoms, 327 bonds, 20 residues, 1 model selected  

> select ~sel & ##selected

13465 atoms, 13602 bonds, 850 residues, 1 model selected  

> select #2/A:631-633

56 atoms, 55 bonds, 3 residues, 1 model selected  

> select #2/A:631-634

70 atoms, 69 bonds, 4 residues, 1 model selected  

> color (#!2 & sel) #7370bbff

> select clear

> show #1.1 models

> hide #1.4 models

> hide #1.3 models

> show #!3 models

> hide #!3 models

> show #1.3 models

> show #1.4 models

> select helix

14048 atoms, 14141 bonds, 1297 residues, 4 models selected  

> select helix6

Expected an objects specifier or a keyword  

> dssp report true

> select add #1

18725 atoms, 18960 bonds, 12 pseudobonds, 1900 residues, 9 models selected  

> select subtract #1

9303 atoms, 9351 bonds, 696 residues, 7 models selected  

> select add #2

15726 atoms, 15881 bonds, 1113 residues, 4 models selected  

> select add #3

19260 atoms, 19520 bonds, 1566 residues, 5 models selected  

> select subtract #2

5469 atoms, 5591 bonds, 696 residues, 4 models selected  

> select subtract #3

Nothing selected  

> select add #1.2

2593 atoms, 333 residues, 1 model selected  

> dssp report true

> show #1.2 models

> show sel cartoons

> dssp report true

> select
> #2/A:45-48,52-54,81-94,106-118,120-122,138-140,143-152,155-164,167-176,183-193,196-207,216-231,249-258,274-277,279-292,294-296,301-305,330-335,368-375,377-384,401-405,417-431,486-502,510-512,548-550,555-579,587-589,591-595,597-599,616-634,648-679,686-688,692-699,725-868

7358 atoms, 7389 bonds, 452 residues, 1 model selected  

> dssp report true

> select add #1.2

9951 atoms, 7389 bonds, 785 residues, 3 models selected  

> select subtract #1.2

7358 atoms, 7389 bonds, 452 residues, 3 models selected  

> select add #1

16780 atoms, 16998 bonds, 12 pseudobonds, 1656 residues, 4 models selected  

> select subtract #1

7358 atoms, 7389 bonds, 452 residues, 5 models selected  

> select add #2

13791 atoms, 13929 bonds, 870 residues, 2 models selected  

> select subtract #2

1 model selected  

> select add #1.2

2593 atoms, 333 residues, 1 model selected  

> hide sel cartoons

> list

Unknown command: list  

> set bgColor white

> set bgColor #ffffff00

> set bgColor black

> set bgColor transparent

> select #1/B:437@CA

1 atom, 1 residue, 1 model selected  

> select up

8 atoms, 7 bonds, 1 residue, 2 models selected  

> select up

168 atoms, 170 bonds, 20 residues, 2 models selected  

> select up

3378 atoms, 3452 bonds, 431 residues, 2 models selected  

> color (#!1 & sel) #4bc76cff

[Repeated 1 time(s)]

> color (#!1 & sel) #45c769ff

> color (#!1 & sel) #3dc765ff

> color (#!1 & sel) #3cc764ff

> color (#!1 & sel) #38c763ff

> color (#!1 & sel) #32c763ff

> color (#!1 & sel) #2fc762ff

> color (#!1 & sel) #27c760ff

> color (#!1 & sel) #21c75fff

> color (#!1 & sel) #20c75fff

> color (#!1 & sel) #1dc75fff

> color (#!1 & sel) #1ac75fff

[Repeated 2 time(s)]

> color (#!1 & sel) #19c75fff

[Repeated 1 time(s)]

> color (#!1 & sel) #18c75fff

> color (#!1 & sel) #15c75dff

> color (#!1 & sel) #14c75cff

> color (#!1 & sel) #13c75aff

> color (#!1 & sel) #13c759ff

> color (#!1 & sel) #12c759ff

> color (#!1 & sel) #12c758ff

> color (#!1 & sel) #12c757ff

> color (#!1 & sel) #13c755ff

> color (#!1 & sel) #13c754ff

> color (#!1 & sel) #13c751ff

> color (#!1 & sel) #13c750ff

[Repeated 1 time(s)]

> color (#!1 & sel) #13c74fff

> color (#!1 & sel) #13c74eff

[Repeated 1 time(s)]

> color (#!1 & sel) #13c74dff

> color (#!1 & sel) #12c74cff

[Repeated 1 time(s)]

> color (#!1 & sel) #12c74bff

> color (#!1 & sel) #11c74aff

> color (#!1 & sel) #0fc747ff

> color (#!1 & sel) #0dc743ff

> color (#!1 & sel) #0bc73fff

> color (#!1 & sel) #0ac73dff

> color (#!1 & sel) #09c73cff

> color (#!1 & sel) #08c73aff

> color (#!1 & sel) #08c739ff

> color (#!1 & sel) #07c737ff

> color (#!1 & sel) #06c736ff

> color (#!1 & sel) #05c735ff

> color (#!1 & sel) #05c734ff

> color (#!1 & sel) #04c733ff

> color (#!1 & sel) #05c732ff

> color (#!1 & sel) #05c72eff

> color (#!1 & sel) #04c72dff

> color (#!1 & sel) #04c72cff

> color (#!1 & sel) #04c72fff

> color (#!1 & sel) #05c736ff

> color (#!1 & sel) #0bc745ff

> color (#!1 & sel) #0cc74bff

> color (#!1 & sel) #0ec752ff

> color (#!1 & sel) #0ec757ff

> color (#!1 & sel) #0dc75aff

> color (#!1 & sel) #0ac763ff

> color (#!1 & sel) #0ac767ff

> color (#!1 & sel) #0ac768ff

> color (#!1 & sel) #08c765ff

> color (#!1 & sel) #07c763ff

> color (#!1 & sel) #07c762ff

> color (#!1 & sel) #06c761ff

> color (#!1 & sel) #06c75fff

> color (#!1 & sel) #06c75eff

> color (#!1 & sel) #06c75aff

> color (#!1 & sel) #06c756ff

> color (#!1 & sel) #06c753ff

> color (#!1 & sel) #07c74cff

> color (#!1 & sel) #08c73fff

> color (#!1 & sel) #08c731ff

> color (#!1 & sel) #08c72aff

[Repeated 1 time(s)]

> color (#!1 & sel) #09c729ff

> color (#!1 & sel) #09c728ff

> color (#!1 & sel) #08c726ff

[Repeated 1 time(s)]

> color (#!1 & sel) #09c726ff

> color (#!1 & sel) #09c725ff

[Repeated 2 time(s)]

> color (#!1 & sel) #09c724ff

> color (#!1 & sel) #0ac724ff

[Repeated 1 time(s)]

> color (#!1 & sel) #0ac723ff

[Repeated 1 time(s)]

> color (#!1 & sel) #09c723ff

> color (#!1 & sel) #09c724ff

> color (#!1 & sel) #0bc72dff

> color (#!1 & sel) #0ec738ff

> color (#!1 & sel) #10c73eff

> color (#!1 & sel) #11c744ff

> color (#!1 & sel) #13c74bff

> color (#!1 & sel) #15c752ff

> color (#!1 & sel) #17c75aff

> color (#!1 & sel) #18c765ff

> color (#!1 & sel) #18c76cff

> color (#!1 & sel) #19c76eff

> color (#!1 & sel) #19c76fff

> color (#!1 & sel) #19c772ff

> color (#!1 & sel) #19c775ff

> color (#!1 & sel) #1ac77bff

> color (#!1 & sel) #1ac77cff

> color (#!1 & sel) #19c77cff

> color (#!1 & sel) #19c77bff

> color (#!1 & sel) #19c77aff

[Repeated 1 time(s)]

> color (#!1 & sel) #19c779ff

> color (#!1 & sel) #18c774ff

> color (#!1 & sel) #19c771ff

> color (#!1 & sel) #19c769ff

> color (#!1 & sel) #19c760ff

> color (#!1 & sel) #18c759ff

> color (#!1 & sel) #17c755ff

> color (#!1 & sel) #16c751ff

> color (#!1 & sel) #14c74dff

> color (#!1 & sel) #14c74cff

> color (#!1 & sel) #13c74bff

[Repeated 1 time(s)]

> color (#!1 & sel) #12c74bff

[Repeated 2 time(s)]

> color (#!1 & sel) #11c74bff

> color (#!1 & sel) #10c74bff

> color (#!1 & sel) #0fc74cff

> color (#!1 & sel) #0fc74dff

> color (#!1 & sel) #0fc74fff

> color (#!1 & sel) #0fc751ff

> color (#!1 & sel) #0fc753ff

> color (#!1 & sel) #0fc755ff

[Repeated 1 time(s)]

> color (#!1 & sel) #0fc756ff

> color (#!1 & sel) #10c757ff

> color (#!1 & sel) #0fc758ff

> color (#!1 & sel) #10c759ff

> color (#!1 & sel) #11c75bff

> color (#!1 & sel) #12c75eff

> color (#!1 & sel) #13c761ff

> color (#!1 & sel) #13c763ff

> color (#!1 & sel) #14c765ff

> color (#!1 & sel) #15c767ff

> color (#!1 & sel) #16c769ff

> color (#!1 & sel) #16c76aff

[Repeated 1 time(s)]

> color (#!1 & sel) #15c769ff

> color (#!1 & sel) #13c769ff

> color (#!1 & sel) #13c768ff

> color (#!1 & sel) #12c767ff

> color (#!1 & sel) #11c767ff

> color (#!1 & sel) #0fc767ff

> color (#!1 & sel) #0dc766ff

[Repeated 1 time(s)]

> color (#!1 & sel) #0cc765ff

> color (#!1 & sel) #0bc765ff

[Repeated 2 time(s)]

> color (#!1 & sel) #0ab75dff

> color (#!1 & sel) #09ab57ff

> color (#!1 & sel) #09a554ff

> color (#!1 & sel) #089e50ff

> color (#!1 & sel) #08914aff

> color (#!1 & sel) #078a46ff

> color (#!1 & sel) #078745ff

> color (#!1 & sel) #078644ff

> color (#!1 & sel) #078041ff

> color (#!1 & sel) #06773dff

> color (#!1 & sel) #06763cff

> color (#!1 & sel) #06753cff

> color (#!1 & sel) #06743bff

> color (#!1 & sel) #06733bff

> color (#!1 & sel) #06733aff

> color (#!1 & sel) #067039ff

> color (#!1 & sel) #066c37ff

> color (#!1 & sel) #066936ff

> color (#!1 & sel) #066734ff

> color (#!1 & sel) #056634ff

[Repeated 1 time(s)]

> color (#!1 & sel) #066835ff

> color (#!1 & sel) #066b37ff

> color (#!1 & sel) #067039ff

> color (#!1 & sel) #06743bff

> color (#!1 & sel) #06773cff

> color (#!1 & sel) #06773dff

> color (#!1 & sel) #06763cff

> color (#!1 & sel) #06753cff

> color (#!1 & sel) #06743bff

> color (#!1 & sel) #06733aff

> color (#!1 & sel) #06713aff

> color (#!1 & sel) #067039ff

[Repeated 1 time(s)]

> color (#!1 & sel) #066f39ff

[Repeated 1 time(s)]

> color (#!1 & sel) #be6f39ff

[Repeated 1 time(s)]

> color (#!1 & sel) #bedc39ff

[Repeated 1 time(s)]

> color (#!1 & sel) #bedcbeff

[Repeated 1 time(s)]

> color (#!1 & sel) #bedbbeff

> color (#!1 & sel) #bed8beff

> color (#!1 & sel) #bed3beff

> color (#!1 & sel) #becdbeff

> color (#!1 & sel) #bec7beff

> color (#!1 & sel) #bec5beff

> color (#!1 & sel) #bec3beff

> color (#!1 & sel) #bec0beff

> color (#!1 & sel) #bebcbeff

> color (#!1 & sel) #bebabeff

[Repeated 1 time(s)]

> color (#!1 & sel) #bebbbeff

> color (#!1 & sel) #bec0beff

> color (#!1 & sel) #bec3beff

> color (#!1 & sel) #becabeff

> color (#!1 & sel) #becdbeff

> color (#!1 & sel) #bed4beff

> color (#!1 & sel) #bed5beff

> color (#!1 & sel) #bed7beff

> color (#!1 & sel) #bed8beff

> color (#!1 & sel) #bedabeff

> color (#!1 & sel) #bedcbeff

> color (#!1 & sel) #bedfbeff

> color (#!1 & sel) #bee1beff

> color (#!1 & sel) #bee2beff

> color (#!1 & sel) #bee4beff

> color (#!1 & sel) #bee7beff

> color (#!1 & sel) #bee8beff

> color (#!1 & sel) #beebbeff

> color (#!1 & sel) #beefbeff

> color (#!1 & sel) #bef3beff

> color (#!1 & sel) #bef9beff

> color (#!1 & sel) #befdbeff

> color (#!1 & sel) #befebeff

> color (#!1 & sel) #beffbeff

[Repeated 1 time(s)]

> color (#!1 & sel) #befebeff

> color (#!1 & sel) #befdbeff

> color (#!1 & sel) #befcbeff

> color (#!1 & sel) #befbbeff

> color (#!1 & sel) #bef9beff

> color (#!1 & sel) #bef6beff

[Repeated 1 time(s)]

> color (#!1 & sel) #bef5beff

> color (#!1 & sel) #bef4beff

> color (#!1 & sel) #bef3beff

> color (#!1 & sel) #bef0beff

> color (#!1 & sel) #beedbeff

> color (#!1 & sel) #beecbeff

> color (#!1 & sel) #beedbeff

> color (#!1 & sel) #beeebeff

> color (#!1 & sel) #bef0beff

[Repeated 1 time(s)]

> color (#!1 & sel) #bef0b5ff

> color (#!1 & sel) #bef0b1ff

> color (#!1 & sel) #bef0afff

> color (#!1 & sel) #bef0aeff

> color (#!1 & sel) #bef0adff

> color (#!1 & sel) #bef0acff

> color (#!1 & sel) #bef0a8ff

> color (#!1 & sel) #bef0a4ff

> color (#!1 & sel) #bef0a0ff

> color (#!1 & sel) #bef09fff

> color (#!1 & sel) #bef09bff

> color (#!1 & sel) #bef093ff

> color (#!1 & sel) #bef092ff

> color (#!1 & sel) #bef094ff

> color (#!1 & sel) #bef097ff

> color (#!1 & sel) #bef09cff

> color (#!1 & sel) #bef0a2ff

> color (#!1 & sel) #bef0a8ff

> color (#!1 & sel) #bef0abff

> color (#!1 & sel) #bef0adff

> color (#!1 & sel) #bef0b1ff

> color (#!1 & sel) #bef0b3ff

> color (#!1 & sel) #bef0b6ff

> color (#!1 & sel) #bef0b8ff

[Repeated 3 time(s)]

> color (#!1 & sel) #b7f0b8ff

> color (#!1 & sel) #aff0b8ff

> color (#!1 & sel) #acf0b8ff

> color (#!1 & sel) #aaf0b8ff

> color (#!1 & sel) #a9f0b8ff

> color (#!1 & sel) #a6f0b8ff

> color (#!1 & sel) #a2f0b8ff

> color (#!1 & sel) #a0f0b8ff

> color (#!1 & sel) #a3f0b8ff

> color (#!1 & sel) #adf0b8ff

> color (#!1 & sel) #c1f0b8ff

> color (#!1 & sel) #d3f0b8ff

> color (#!1 & sel) #d7f0b8ff

> color (#!1 & sel) #dcf0b8ff

> color (#!1 & sel) #e1f0b8ff

> color (#!1 & sel) #e5f0b8ff

> color (#!1 & sel) #e9f0b8ff

> color (#!1 & sel) #edf0b8ff

> color (#!1 & sel) #eff0b8ff

> color (#!1 & sel) #f2f0b8ff

[Repeated 1 time(s)]

> color (#!1 & sel) #f1f0b8ff

> color (#!1 & sel) #e8f0b8ff

> color (#!1 & sel) #dbf0b8ff

> color (#!1 & sel) #d6f0b8ff

> color (#!1 & sel) #d3f0b8ff

> color (#!1 & sel) #d1f0b8ff

> color (#!1 & sel) #cff0b8ff

> color (#!1 & sel) #cdf0b8ff

> color (#!1 & sel) #cbf0b8ff

> color (#!1 & sel) #caf0b8ff

> color (#!1 & sel) #c8f0b8ff

> color (#!1 & sel) #c6f0b8ff

> color (#!1 & sel) #c3f0b8ff

> color (#!1 & sel) #c1f0b8ff

> color (#!1 & sel) #c0f0b8ff

> color (#!1 & sel) #bff0b8ff

> color (#!1 & sel) #bdf0b8ff

> color (#!1 & sel) #bcf0b8ff

> color (#!1 & sel) #bbf0b8ff

> color (#!1 & sel) #b9f0b8ff

> color (#!1 & sel) #b8f0b8ff

> color (#!1 & sel) #b7f0b8ff

[Repeated 1 time(s)]

> color (#!1 & sel) #b6f0b8ff

> color (#!1 & sel) #b5f0b8ff

> color (#!1 & sel) #b2f0b8ff

> color (#!1 & sel) #aef0b8ff

> color (#!1 & sel) #acf0b8ff

> color (#!1 & sel) #abf0b8ff

[Repeated 3 time(s)]

> color (#!1 & sel) #acf0b8ff

> color (#!1 & sel) #aff0b8ff

> color (#!1 & sel) #b3f0b8ff

> color (#!1 & sel) #b5f0b8ff

> color (#!1 & sel) #bcf0b8ff

> color (#!1 & sel) #bef0b8ff

> color (#!1 & sel) #bff0b8ff

> color (#!1 & sel) #c0f0b8ff

> color (#!1 & sel) #c1f0b8ff

[Repeated 1 time(s)]

> color (#!1 & sel) #c2f0b8ff

[Repeated 3 time(s)]

> color (#!1 & sel) #c0f0b8ff

> color (#!1 & sel) #bef0b8ff

> color (#!1 & sel) #bdf0b8ff

[Repeated 2 time(s)]

> select clear

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

> select #2/A:339

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select #2/A:338

22 atoms, 21 bonds, 1 residue, 1 model selected  

> select #2/A:365

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select #2/A:413

15 atoms, 14 bonds, 1 residue, 1 model selected  

> select #2/A:338,365,413

48 atoms, 45 bonds, 3 residues, 1 model selected  

> show sel atoms

> color sel red target acspfl

> style sel ball

Changed 48 atom styles  

> style sel sphere

Changed 48 atom styles  

> style sel stick

Changed 48 atom styles  

> style sel ball

Changed 48 atom styles  

> select clear

> select N

3718 atoms, 2763 residues, 4 models selected  

> select clear

[Repeated 1 time(s)]

> select #2/A:648

15 atoms, 14 bonds, 1 residue, 1 model selected  

> select #2/A:647

10 atoms, 9 bonds, 1 residue, 1 model selected  

> turn z 5 center #2/A:646@ca atoms #2/A:647-870

> undo

[Repeated 1 time(s)]

> redo

> undo

> redo

[Repeated 2 time(s)]No redo action is available  

> undo

> turn z -5 center #2/A:646@ca atoms #2/A:647-870

> turn y -5 center #2/A:646@ca atoms #2/A:647-870

> turn y 5 center #2/A:646@ca atoms #2/A:647-870

> turn x 20 center #2/A:646@ca atoms #2/A:647-870

[Repeated 1 time(s)]

> select #2/A:720

19 atoms, 18 bonds, 1 residue, 1 model selected  

> turn x -40 center #2/A:720@ca atoms #2/A:721-870

> turn x 80 center #2/A:720@ca atoms #2/A:721-870

> turn x 40 center #2/A:720@ca atoms #2/A:721-870

> turn z 40 center #2/A:720@ca atoms #2/A:721-870

> select clear

> select #2/A:338,365,413

48 atoms, 45 bonds, 3 residues, 1 model selected  

> color (#!2 & sel) #7370bbff

> hide sel atoms

> select clear

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

> select #2/A:634

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select #2/A:619

15 atoms, 14 bonds, 1 residue, 1 model selected  

> select clear

> select #2/A:532

22 atoms, 21 bonds, 1 residue, 1 model selected  

> select clear

> select #2/A:531

17 atoms, 16 bonds, 1 residue, 1 model selected  

> select #2/A:526

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select #2/A:527

14 atoms, 13 bonds, 1 residue, 1 model selected  

> select #2/A:619-634,527-539

471 atoms, 471 bonds, 29 residues, 1 model selected  

> select #2/A:619-634,537-539

313 atoms, 313 bonds, 19 residues, 1 model selected  

> select #2/A:619-634,527-529

299 atoms, 298 bonds, 19 residues, 1 model selected  

> select #2/A:619-634,527-531

331 atoms, 330 bonds, 21 residues, 1 model selected  

> select #2/A:619-634,527-531

331 atoms, 330 bonds, 21 residues, 1 model selected  

> color sel cyan target acspfl

> color sel #7370bbff

> select clear

> select #2/A:616

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select clear

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

[Repeated 1 time(s)]

——— End of log from Fri May 23 17:49:00 2025 ———

opened ChimeraX session  

> close #2.1

> split #2 atoms :1-310 atoms :311-634 atoms :635-870

Split HT-KIF5B[1-560] (#2) into 3 models  
Chain information for HT-KIF5B[1-560] 1 #2.1  
---  
Chain | Description  
A | No description available  
  
Chain information for HT-KIF5B[1-560] 2 #2.2  
---  
Chain | Description  
A | No description available  
  
Chain information for HT-KIF5B[1-560] 3 #2.3  
---  
Chain | Description  
A | No description available  
  

> hide #!2 models

> hide #2.3 models

> hide #!1 models

> show #!1 models

> hide #1.4 models

> hide #1.3 models

Drag select of 35 atoms, 5 pseudobonds, 33 bonds  

> combine sel modelId #2.2

Traceback (most recent call last):  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/cmd_line/tool.py", line 319, in execute  
cmd.run(cmd_text)  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/commands/cli.py", line 3213, in run  
result = ci.function(session, **kw_args)  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/cmd.py", line 174, in combine_cmd  
session.models.add([combination])  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/models.py", line 758, in add  
p = self._parent_for_added_model(model, parent, root_model = root_model)  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/models.py", line 828, in _parent_for_added_model  
raise ValueError('Tried to add model %s with the same id as another model %s'  
ValueError: Tried to add model copy of 4hna: KHC + TA/B #2.2 with the same id
as another model HT-KIF5B[1-560] 2 #2.2  
  
ValueError: Tried to add model copy of 4hna: KHC + TA/B #2.2 with the same id
as another model HT-KIF5B[1-560] 2 #2.2  
  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/models.py", line 828, in _parent_for_added_model  
raise ValueError('Tried to add model %s with the same id as another model %s'  
  
See log for complete Python traceback.  
  

> select add #2.2

5081 atoms, 5118 bonds, 5 pseudobonds, 329 residues, 3 models selected  

> combine sel modelId #4

Remapping chain ID 'A' in HT-KIF5B[1-560] 2 #2.2 to 'C'  

> select clear

> hide #!1 models

> show #!2 models

> hide #!2 models

> hide #2.1 models

> hide #2.2 models

> hide #1.1 models

> hide #1.2 models

> hide #!4 models

> show #!4 models

> hide #4.1 models

> show #4.1 models

> hide #4.1 models

> hide #!4 models

> show #!4 models

> show #4.1 models

> hide #4.1 models

> show #4.1 models

> hide #4.1 models

> show #4.1 models

> close#4.1

Unknown command: close#4.1  

> close #4.1

> undo

> redo

> hide #4 models

> show #4 models

Drag select of 67 atoms, 68 bonds  

> delete sel

> select clear

> close #2.2

> rename #4 #2.2

No name or id option specified for renaming  

> rename #4 modelId #2.2

Expected a keyword  

> rename #4 id #2.2

> show #!2 models

> show #2.1 models

> show #2.3 models

> hide #2.3 models

> show #2.3 models

> hide #2.3 models

> show #2.3 models

> hide #2.3 models

> show #2.3 models

> hide #2.3 models

> rename #2.3 "Neck Linker + Stalk"

> rename #2.2 "Motor Domain"

> rename #2.1 "HaloTag + Linker"

> hide #2.1 models

> show #2.1 models

> select up

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

27 atoms, 29 bonds, 1 residue, 1 model selected  

> select up

5 atoms, 4 bonds, 1 residue, 1 model selected  

> select up

2628 atoms, 2665 bonds, 338 residues, 1 model selected  

> show sel atoms

> select down

5 atoms, 4 bonds, 1 residue, 1 model selected  

> undo

[Repeated 1 time(s)]

> select clear

> select up

2 atoms, 1 bond, 1 residue, 1 model selected  

> select up

27 atoms, 29 bonds, 1 residue, 1 model selected  

> select up

2628 atoms, 2665 bonds, 338 residues, 1 model selected  

> delete sel

> select clear

> select #2.2/C:617

21 atoms, 21 bonds, 1 residue, 1 model selected  

> select up

300 atoms, 301 bonds, 19 residues, 1 model selected  

> select up

5046 atoms, 5085 bonds, 324 residues, 1 model selected  

> select up

11773 atoms, 11961 bonds, 1185 residues, 1 model selected  

> select up

20518 atoms, 20803 bonds, 1731 residues, 3 models selected  

> select down

11773 atoms, 11961 bonds, 1185 residues, 1 model selected  

> select up

20518 atoms, 20803 bonds, 1731 residues, 3 models selected  

> select down

11773 atoms, 11961 bonds, 1185 residues, 1 model selected  

> show sel cartoons

> select #2.2/C:627

19 atoms, 18 bonds, 1 residue, 1 model selected  

> select up

300 atoms, 301 bonds, 19 residues, 1 model selected  

> select up

5046 atoms, 5085 bonds, 324 residues, 1 model selected  

> select ~sel & ##selected

6727 atoms, 6876 bonds, 861 residues, 1 model selected  

> delete sel

> select #2.2/C:355

14 atoms, 14 bonds, 1 residue, 1 model selected  

> select up

67 atoms, 68 bonds, 4 residues, 1 model selected  

> select up

5046 atoms, 5085 bonds, 324 residues, 1 model selected  

> select add #2.1

9940 atoms, 10061 bonds, 634 residues, 2 models selected  

> select subtract #2.1

5046 atoms, 5085 bonds, 324 residues, 1 model selected  

> hide #2.1 models

> show #2.1 models

> show #2.3 models

> hide #2.3 models

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

> select clear

> show #2.3 models

> hide #2.1 models

> rename #3 mEGFP-alpha-Tubulin

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

——— End of log from Fri May 23 18:38:32 2025 ———

opened ChimeraX session  

> hide #!2 models

> show #!1 models

Drag select of 35 atoms, 33 bonds  

> combine sel modelId #4

> hide #!1 models

> undo

> select clear

> delete #4

> hide #!1 models

> show #!1 models

> show #1.1 models

> show #1.2 models

> show #1.3 models

> show #1.4 models

> select add #1

9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 2 models selected  

> show sel cartoons

> select #1/K:401@C1'

1 atom, 1 residue, 1 model selected  

> select up

27 atoms, 29 bonds, 1 residue, 1 model selected  

> select up

2628 atoms, 2665 bonds, 338 residues, 1 model selected  

> combine sel #4 modelId

Expected a keyword  

> combine sel modelId #4

> hide #!1 models

> select add #1

9422 atoms, 9609 bonds, 12 pseudobonds, 1204 residues, 3 models selected  

> select subtract #1

3 models selected  

> hide #1.1 models

> hide #1.2 models

> hide #1.3 models

> hide #1.4 models

> hide #!4 models

> show #!4 models

> hide #4.1 models

> show #4.1 models

> hide #4.1 models

> show #4.1 models

> select #4/A:424

8 atoms, 7 bonds, 1 residue, 1 model selected  

> select up

141 atoms, 142 bonds, 17 residues, 1 model selected  

> select up

3061 atoms, 3130 bonds, 392 residues, 1 model selected  

> select up

3131 atoms, 3201 bonds, 402 residues, 1 model selected  

> select up

3349 atoms, 3424 bonds, 430 residues, 1 model selected  

> select up

3382 atoms, 3458 bonds, 432 residues, 1 model selected  

> select up

9422 atoms, 9609 bonds, 1204 residues, 1 model selected  

> select down

3382 atoms, 3458 bonds, 432 residues, 1 model selected  

> delete sel

> select #4/B:253

11 atoms, 10 bonds, 1 residue, 1 model selected  

> select up

64 atoms, 63 bonds, 8 residues, 1 model selected  

> select up

3378 atoms, 3452 bonds, 431 residues, 1 model selected  

> select up

3412 atoms, 3486 bonds, 434 residues, 1 model selected  

> select up

6040 atoms, 6151 bonds, 772 residues, 1 model selected  

> select down

3412 atoms, 3486 bonds, 434 residues, 1 model selected  

> delete sel

> select #4/K:309

9 atoms, 8 bonds, 1 residue, 1 model selected  

> select up

104 atoms, 104 bonds, 13 residues, 1 model selected  

> select up

2593 atoms, 2632 bonds, 333 residues, 1 model selected  

> delete sel

> select #4/K:401@PA

1 atom, 1 residue, 1 model selected  

> select up

27 atoms, 29 bonds, 1 residue, 1 model selected  

> select up

35 atoms, 33 bonds, 5 residues, 1 model selected  

> select up

9457 atoms, 9642 bonds, 1209 residues, 4 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select down

9457 atoms, 9642 bonds, 1209 residues, 7 models selected  

> select down

35 atoms, 33 bonds, 5 residues, 4 models selected  

> select add #4

35 atoms, 33 bonds, 5 pseudobonds, 5 residues, 2 models selected  

> select subtract #4

Nothing selected  

> select add #4.1

5 pseudobonds, 1 model selected  

> select up

35 atoms, 33 bonds, 5 pseudobonds, 5 residues, 2 models selected  

> undo

[Repeated 10 time(s)]No undo action is available  

> select up

9457 atoms, 9642 bonds, 1209 residues, 4 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> select up

9457 atoms, 9642 bonds, 12 pseudobonds, 1209 residues, 8 models selected  

> show sel & #!4 atoms

[Repeated 1 time(s)]

> show #!1 models

> hide #!1 models

Cell requested for row 0 is out of bounds for table with 14 rows! Resizing
table model.  

> show #!1 models

> show #!2 models

Cell requested for row 2 is out of bounds for table with 10 rows! Resizing
table model.  

> show #!3 models

Cell requested for row 0 is out of bounds for table with 7 rows! Resizing
table model.  

> select subtract #1

35 atoms, 33 bonds, 5 residues, 6 models selected  

> select add #2

13826 atoms, 13960 bonds, 875 residues, 6 models selected  

> select add #3

19295 atoms, 19551 bonds, 1571 residues, 8 models selected  

> select add #1

28717 atoms, 29160 bonds, 12 pseudobonds, 2775 residues, 10 models selected  

> select subtract #1

19295 atoms, 19551 bonds, 1571 residues, 11 models selected  

> select subtract #2

5504 atoms, 5624 bonds, 701 residues, 4 models selected  

> select add #2

19295 atoms, 19551 bonds, 1571 residues, 8 models selected  

> select subtract #2

5504 atoms, 5624 bonds, 701 residues, 4 models selected  

> select subtract #3

35 atoms, 33 bonds, 5 residues, 1 model selected  

> select add #4

35 atoms, 33 bonds, 5 pseudobonds, 5 residues, 2 models selected  

> select subtract #4

Nothing selected  

> select add #4

35 atoms, 33 bonds, 5 pseudobonds, 5 residues, 2 models selected  

> rename #4.1 id #5

> hide #5 models

> show #5 models

> save "/Users/nukakola/Library/Mobile Documents/com~apple~CloudDocs/My
> Documents/Academics/PhD EMBL VBC/3 Lab/02 Kinesin Tracking/_Structural
> Analysis of Kinesin HC and MTs/HT-KIF5B[1-560] on Tubulin.cxs"

——— End of log from Fri May 23 18:50:52 2025 ———

opened ChimeraX session  

> delete #4

Traceback (most recent call last):  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/triggerset.py", line 149, in invoke  
return self._func(self._name, data)  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/model_panel/tool.py", line 214, in <lambda>  
lambda *args, ft=self._fill_tree, ar=always_rebuild: ft(always_rebuild=ar))  
^^^^^^^^^^^^^^^^^^^^^  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/model_panel/tool.py", line 247, in _fill_tree  
all_selected_models = self.session.selection.models(all_selected=True)  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/selection.py", line 40, in models  
return [m for m in self._all_models if m.get_selected(include_children=True,
fully=True)]  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/core/selection.py", line 40, in <listcomp>  
return [m for m in self._all_models if m.get_selected(include_children=True,
fully=True)]  
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/pbgroup.py", line 108, in get_selected  
if self.pseudobonds.num_selected < self.num_pseudobonds:  
^^^^^^^^^^^^^^^^  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/molc.py", line 174, in get_prop  
vcount = getattr(self, value_count)  
^^^^^^^^^^^^^^^^^^^^^^^^^^  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/molc.py", line 106, in get_prop  
cget(self._c_pointer_ref, 1, v_ref)  
^^^^^^^^^^^^^^^^^^^  
AttributeError: 'PseudobondGroup' object has no attribute '_c_pointer_ref'  
  
Error processing trigger "new frame":  
AttributeError: 'PseudobondGroup' object has no attribute '_c_pointer_ref'  
  
File
"/Applications/ChimeraX-1.9.app/Contents/Library/Frameworks/Python.framework/Versions/3.11/lib/python3.11/site-
packages/chimerax/atomic/molc.py", line 106, in get_prop  
cget(self._c_pointer_ref, 1, v_ref)  
^^^^^^^^^^^^^^^^^^^  
  
See log for complete Python traceback.  
  




OpenGL version: 4.1 Metal - 89.4
OpenGL renderer: Apple M1 Max
OpenGL vendor: Apple

Python: 3.11.4
Locale: en_US.UTF-8
Qt version: PyQt6 6.7.1, Qt 6.7.1
Qt runtime version: 6.7.3
Qt platform: cocoa
Hardware:

    Hardware Overview:

      Model Name: MacBook Pro
      Model Identifier: MacBookPro18,2
      Model Number: Z14X000HQLL/A
      Chip: Apple M1 Max
      Total Number of Cores: 10 (8 performance and 2 efficiency)
      Memory: 64 GB
      System Firmware Version: 11881.121.1
      OS Loader Version: 11881.121.1

Software:

    System Software Overview:

      System Version: macOS 15.5 (24F74)
      Kernel Version: Darwin 24.5.0
      Time since boot: 3 days, 9 hours, 25 minutes

Graphics/Displays:

    Apple M1 Max:

      Chipset Model: Apple M1 Max
      Type: GPU
      Bus: Built-In
      Total Number of Cores: 32
      Vendor: Apple (0x106b)
      Metal Support: Metal 3
      Displays:
        Color LCD:
          Display Type: Built-in Liquid Retina XDR Display
          Resolution: 3456 x 2234 Retina
          Main Display: Yes
          Mirror: Off
          Online: Yes
          Automatically Adjust Brightness: No
          Connection Type: Internal


Installed Packages:
    alabaster: 1.0.0
    anyio: 4.7.0
    appdirs: 1.4.4
    appnope: 0.1.4
    asttokens: 3.0.0
    auditwheel: 6.1.0
    babel: 2.16.0
    beautifulsoup4: 4.12.3
    blockdiag: 3.0.0
    blosc2: 3.0.0
    build: 1.2.1
    certifi: 2023.11.17
    cftime: 1.6.4.post1
    charset-normalizer: 3.4.0
    ChimeraX-AddCharge: 1.5.18
    ChimeraX-AddH: 2.2.6
    ChimeraX-AlignmentAlgorithms: 2.0.2
    ChimeraX-AlignmentHdrs: 3.5
    ChimeraX-AlignmentMatrices: 2.1
    ChimeraX-Alignments: 2.16.1
    ChimeraX-AlphaFold: 1.0.1
    ChimeraX-AltlocExplorer: 1.1.2
    ChimeraX-AmberInfo: 1.0
    ChimeraX-Arrays: 1.1
    ChimeraX-Atomic: 1.58.8
    ChimeraX-AtomicLibrary: 14.1.11
    ChimeraX-AtomSearch: 2.0.1
    ChimeraX-AxesPlanes: 2.4
    ChimeraX-BasicActions: 1.1.2
    ChimeraX-BILD: 1.0
    ChimeraX-BlastProtein: 3.0.0
    ChimeraX-BondRot: 2.0.4
    ChimeraX-BugReporter: 1.0.1
    ChimeraX-BuildStructure: 2.13.1
    ChimeraX-Bumps: 1.0
    ChimeraX-BundleBuilder: 1.4.0
    ChimeraX-ButtonPanel: 1.0.1
    ChimeraX-CageBuilder: 1.0.1
    ChimeraX-CellPack: 1.0
    ChimeraX-Centroids: 1.4
    ChimeraX-ChangeChains: 1.1
    ChimeraX-CheckWaters: 1.4
    ChimeraX-ChemGroup: 2.0.1
    ChimeraX-Clashes: 2.3
    ChimeraX-ColorActions: 1.0.5
    ChimeraX-ColorGlobe: 1.0
    ChimeraX-ColorKey: 1.5.6
    ChimeraX-CommandLine: 1.2.5
    ChimeraX-ConnectStructure: 2.0.1
    ChimeraX-Contacts: 1.0.1
    ChimeraX-Core: 1.9
    ChimeraX-CoreFormats: 1.2
    ChimeraX-coulombic: 1.4.4
    ChimeraX-Crosslinks: 1.0
    ChimeraX-Crystal: 1.0
    ChimeraX-CrystalContacts: 1.0.1
    ChimeraX-DataFormats: 1.2.3
    ChimeraX-Dicom: 1.2.6
    ChimeraX-DistMonitor: 1.4.2
    ChimeraX-DockPrep: 1.1.3
    ChimeraX-Dssp: 2.0
    ChimeraX-EMDB-SFF: 1.0
    ChimeraX-ESMFold: 1.0
    ChimeraX-FileHistory: 1.0.1
    ChimeraX-FunctionKey: 1.0.1
    ChimeraX-Geometry: 1.3
    ChimeraX-gltf: 1.0
    ChimeraX-Graphics: 1.4.1
    ChimeraX-Hbonds: 2.5
    ChimeraX-Help: 1.3
    ChimeraX-HKCage: 1.3
    ChimeraX-IHM: 1.1
    ChimeraX-ImageFormats: 1.2
    ChimeraX-IMOD: 1.0
    ChimeraX-IO: 1.0.3
    ChimeraX-ItemsInspection: 1.0.1
    ChimeraX-IUPAC: 1.0
    ChimeraX-KVFinder: 1.2.1
    ChimeraX-Label: 1.1.14
    ChimeraX-ListInfo: 1.2.2
    ChimeraX-Log: 1.2
    ChimeraX-LookingGlass: 1.1
    ChimeraX-Maestro: 1.9.1
    ChimeraX-Map: 1.3
    ChimeraX-MapData: 2.0
    ChimeraX-MapEraser: 1.0.1
    ChimeraX-MapFilter: 2.0.1
    ChimeraX-MapFit: 2.0
    ChimeraX-MapSeries: 2.1.1
    ChimeraX-Markers: 1.0.1
    ChimeraX-Mask: 1.0.2
    ChimeraX-MatchMaker: 2.1.6
    ChimeraX-MCopy: 1.0
    ChimeraX-MDcrds: 2.7.2
    ChimeraX-MedicalToolbar: 1.1
    ChimeraX-Meeting: 1.0.1
    ChimeraX-MLP: 1.1.1
    ChimeraX-mmCIF: 2.14.2
    ChimeraX-MMTF: 2.2
    ChimeraX-ModelArchive: 1.0
    ChimeraX-Modeller: 1.5.18
    ChimeraX-ModelPanel: 1.5
    ChimeraX-ModelSeries: 1.0.1
    ChimeraX-Mol2: 2.0.3
    ChimeraX-Mole: 1.0
    ChimeraX-Morph: 1.0.2
    ChimeraX-MouseModes: 1.2
    ChimeraX-Movie: 1.0
    ChimeraX-MutationScores: 1.0
    ChimeraX-Neuron: 1.0
    ChimeraX-Nifti: 1.2
    ChimeraX-NMRSTAR: 1.0.2
    ChimeraX-NRRD: 1.2
    ChimeraX-Nucleotides: 2.0.3
    ChimeraX-OpenCommand: 1.14
    ChimeraX-OrthoPick: 1.0.1
    ChimeraX-PDB: 2.7.6
    ChimeraX-PDBBio: 1.0.1
    ChimeraX-PDBLibrary: 1.0.4
    ChimeraX-PDBMatrices: 1.0
    ChimeraX-PickBlobs: 1.0.1
    ChimeraX-Positions: 1.0
    ChimeraX-PresetMgr: 1.1.2
    ChimeraX-PubChem: 2.2
    ChimeraX-ReadPbonds: 1.0.1
    ChimeraX-Registration: 1.1.2
    ChimeraX-RemoteControl: 1.0
    ChimeraX-RenderByAttr: 1.6.2
    ChimeraX-RenumberResidues: 1.1
    ChimeraX-ResidueFit: 1.0.1
    ChimeraX-RestServer: 1.3.1
    ChimeraX-RNALayout: 1.0
    ChimeraX-RotamerLibMgr: 4.0
    ChimeraX-RotamerLibsDunbrack: 2.0
    ChimeraX-RotamerLibsDynameomics: 2.0
    ChimeraX-RotamerLibsRichardson: 2.0
    ChimeraX-SaveCommand: 1.5.1
    ChimeraX-SchemeMgr: 1.0
    ChimeraX-SDF: 2.0.2
    ChimeraX-Segger: 1.0
    ChimeraX-Segment: 1.0.1
    ChimeraX-Segmentations: 3.5.6
    ChimeraX-SelInspector: 1.0
    ChimeraX-SeqView: 2.14
    ChimeraX-Shape: 1.0.1
    ChimeraX-Shell: 1.0.1
    ChimeraX-Shortcuts: 1.2.0
    ChimeraX-ShowSequences: 1.0.3
    ChimeraX-SideView: 1.0.1
    ChimeraX-SimilarStructures: 1.0.1
    ChimeraX-Smiles: 2.1.2
    ChimeraX-SmoothLines: 1.0
    ChimeraX-SpaceNavigator: 1.0
    ChimeraX-StdCommands: 1.18.1
    ChimeraX-STL: 1.0.1
    ChimeraX-Storm: 1.0
    ChimeraX-StructMeasure: 1.2.1
    ChimeraX-Struts: 1.0.1
    ChimeraX-Surface: 1.0.1
    ChimeraX-SwapAA: 2.0.1
    ChimeraX-SwapRes: 2.5
    ChimeraX-TapeMeasure: 1.0
    ChimeraX-TaskManager: 1.0
    ChimeraX-Test: 1.0
    ChimeraX-Toolbar: 1.2.3
    ChimeraX-ToolshedUtils: 1.2.4
    ChimeraX-Topography: 1.0
    ChimeraX-ToQuest: 1.0
    ChimeraX-Tug: 1.0.1
    ChimeraX-UI: 1.41
    ChimeraX-Umap: 1.0
    ChimeraX-uniprot: 2.3.1
    ChimeraX-UnitCell: 1.0.1
    ChimeraX-ViewDockX: 1.4.4
    ChimeraX-VIPERdb: 1.0
    ChimeraX-Vive: 1.1
    ChimeraX-VolumeMenu: 1.0.1
    ChimeraX-vrml: 1.0
    ChimeraX-VTK: 1.0
    ChimeraX-WavefrontOBJ: 1.0
    ChimeraX-WebCam: 1.0.2
    ChimeraX-WebServices: 1.1.4
    ChimeraX-Zone: 1.0.1
    colorama: 0.4.6
    comm: 0.2.2
    contourpy: 1.3.1
    cxservices: 1.2.3
    cycler: 0.12.1
    Cython: 3.0.10
    debugpy: 1.8.9
    decorator: 5.1.1
    docutils: 0.21.2
    executing: 2.1.0
    filelock: 3.15.4
    fonttools: 4.55.3
    funcparserlib: 2.0.0a0
    glfw: 2.8.0
    grako: 3.16.5
    h11: 0.14.0
    h5py: 3.12.1
    html2text: 2024.2.26
    httpcore: 1.0.7
    httpx: 0.28.1
    idna: 3.10
    ihm: 1.3
    imagecodecs: 2024.6.1
    imagesize: 1.4.1
    ipykernel: 6.29.5
    ipython: 8.26.0
    ipywidgets: 8.1.5
    jedi: 0.19.1
    Jinja2: 3.1.4
    jupyter_client: 8.6.2
    jupyter_core: 5.7.2
    jupyterlab_widgets: 3.0.13
    kiwisolver: 1.4.7
    line_profiler: 4.1.3
    lxml: 5.2.2
    lz4: 4.3.3
    MarkupSafe: 3.0.2
    matplotlib: 3.9.2
    matplotlib-inline: 0.1.7
    msgpack: 1.0.8
    ndindex: 1.9.2
    nest-asyncio: 1.6.0
    netCDF4: 1.6.5
    networkx: 3.3
    nibabel: 5.2.0
    nptyping: 2.5.0
    numexpr: 2.10.2
    numpy: 1.26.4
    openvr: 1.26.701
    packaging: 23.2
    ParmEd: 4.2.2
    parso: 0.8.4
    pep517: 0.13.1
    pexpect: 4.9.0
    pillow: 10.4.0
    pip: 24.2
    pkginfo: 1.11.1
    platformdirs: 4.3.6
    prompt_toolkit: 3.0.48
    psutil: 6.0.0
    ptyprocess: 0.7.0
    pure_eval: 0.2.3
    py-cpuinfo: 9.0.0
    pycollada: 0.8
    pydicom: 2.4.4
    pyelftools: 0.31
    Pygments: 2.18.0
    pynmrstar: 3.3.4
    pynrrd: 1.0.0
    PyOpenGL: 3.1.7
    PyOpenGL-accelerate: 3.1.7
    pyopenxr: 1.0.3401
    pyparsing: 3.2.0
    pyproject_hooks: 1.2.0
    PyQt6-commercial: 6.7.1
    PyQt6-Qt6: 6.7.3
    PyQt6-WebEngine-commercial: 6.7.0
    PyQt6-WebEngine-Qt6: 6.7.3
    PyQt6-WebEngineSubwheel-Qt6: 6.7.3
    PyQt6_sip: 13.8.0
    python-dateutil: 2.9.0.post0
    pytz: 2024.2
    pyzmq: 26.2.0
    qtconsole: 5.5.2
    QtPy: 2.4.2
    qtshim: 1.0
    RandomWords: 0.4.0
    requests: 2.32.3
    scipy: 1.14.0
    setuptools: 72.1.0
    sfftk-rw: 0.8.1
    six: 1.16.0
    sniffio: 1.3.1
    snowballstemmer: 2.2.0
    sortedcontainers: 2.4.0
    soupsieve: 2.6
    Sphinx: 8.0.2
    sphinx-autodoc-typehints: 2.2.3
    sphinxcontrib-applehelp: 2.0.0
    sphinxcontrib-blockdiag: 3.0.0
    sphinxcontrib-devhelp: 2.0.0
    sphinxcontrib-htmlhelp: 2.1.0
    sphinxcontrib-jsmath: 1.0.1
    sphinxcontrib-qthelp: 2.0.0
    sphinxcontrib-serializinghtml: 2.0.0
    stack-data: 0.6.3
    superqt: 0.6.3
    tables: 3.10.1
    tcia_utils: 1.5.1
    tifffile: 2024.7.24
    tinyarray: 1.2.4
    tornado: 6.4.2
    traitlets: 5.14.3
    typing_extensions: 4.12.2
    tzdata: 2024.2
    urllib3: 2.2.3
    wcwidth: 0.2.13
    webcolors: 24.6.0
    wheel: 0.43.0
    wheel-filename: 1.4.1
    widgetsnbextension: 4.0.13

Change History (2)

comment:1 by Eric Pettersen, 14 months ago

Component: UnassignedStructure Editing
Owner: set to Eric Pettersen
Platform: all
Project: ChimeraX
Status: newaccepted
Summary: ChimeraX bug report submissionCombine into existing ID

Convert the ValueError (and make it a subclass of ValueError) into a UserError instead of a traceback (and dispose of the model).

comment:2 by Eric Pettersen, 13 months ago

Resolution: fixed
Status: acceptedclosed
Note: See TracTickets for help on using tickets.