#17868 closed defect (fixed)
AlphaFold: update best model
| Reported by: | Owned by: | Tom Goddard | |
|---|---|---|---|
| Priority: | normal | Milestone: | |
| Component: | Structure Prediction | Version: | |
| Keywords: | Cc: | ||
| Blocked By: | Blocking: | ||
| Notify when closed: | Platform: | all | |
| Project: | ChimeraX |
Description
The following bug report has been submitted:
Platform: Windows-10-10.0.26100
ChimeraX Version: 1.9 (2024-12-11 19:11:19 UTC)
Description
I don't know if this is a bug or a mistake on my part. If I run an AlphaFold predict, everything works fine and the best model shows up. If, in the same AlphaFold instance, I mutate the sequence, AlphaFold again runs correctly but the old best model shows up instead of the new one. If I go to the ChimeraX directory and rename the most recent prediction directory and run AlphaFold again, the correct best model shows up. For reference, I'm using this to show students how mutations might affect secondary structure.
Log:
UCSF ChimeraX version: 1.9 (2024-12-11)
© 2016-2024 Regents of the University of California. All rights reserved.
> open "C:\Users\hemmecl\Desktop\MIC Business\Projects\Abby Molecule\2.24.cxs"
> format session
Log from Mon Feb 24 15:23:30 2025UCSF ChimeraX version: 1.7.1 (2024-01-23)
© 2016-2023 Regents of the University of California. All rights reserved.
> open /Users/abby/Desktop/Printing/2.24.cxs
Log from Mon Feb 24 14:46:23 2025UCSF ChimeraX version: 1.7.1 (2024-01-23)
© 2016-2023 Regents of the University of California. All rights reserved.
> open "/Users/abby/Desktop/Printing/ribosome tRNA sphere.cxs" format session
Log from Mon Feb 24 14:16:52 2025UCSF ChimeraX version: 1.7.1 (2024-01-23)
© 2016-2023 Regents of the University of California. All rights reserved.
> open /Users/abby/Desktop/Printing/ribosome_subunits_colored.cxs format
> session
Log from Sun Feb 23 20:08:11 2025UCSF ChimeraX version: 1.7.1 (2024-01-23)
© 2016-2023 Regents of the University of California. All rights reserved.
> open /Users/abby/Desktop/Printing/feb10.cxs
Log from Mon Feb 10 14:53:36 2025 Startup Messages
---
note | available bundle cache has not been initialized yet
UCSF ChimeraX version: 1.7.1 (2024-01-23)
© 2016-2023 Regents of the University of California. All rights reserved.
How to cite UCSF ChimeraX
> open "/Users/abby/Desktop/Printing/grey/One 70S subunit.stl"
Opened STL file One 70S subunit.stl containing 3182520 triangles
> open "/Users/abby/Desktop/Printing/grey/One 70S subunit.stl"
Opened STL file One 70S subunit.stl containing 3182520 triangles
> open 4y4p format mmcif fromDatabase pdb
4y4p title:
Crystal structure of the Thermus thermophilus 70S ribosome with rRNA
modifications and bound to mRNA and A-, P- and E-site tRNAs at 2.5A resolution
[more info...]
Chain information for 4y4p #3
---
Chain | Description | UniProt
10 20 | 50S ribosomal protein L27 | RL27_THET8 1-85
11 21 | 50S ribosomal protein L28 | RL28_THET8 1-98
12 22 | 50S ribosomal protein L29 | RL29_THET8 1-72
13 23 | 50S ribosomal protein L30 | RL30_THET8 1-60
14 24 | 50S ribosomal protein L31 | RL31_THET8 1-71
15 25 | 50S ribosomal protein L32 | RL32_THET8 1-60
16 26 | 50S ribosomal protein L33 | RL33_THET8 1-54
17 27 | 50S ribosomal protein L34 | RL34_THET8 1-49
18 28 | 50S ribosomal protein L35 | RL35_THET8 1-65
19 29 | 50S ribosomal protein L36 | RL36_THET8 1-37
1A 2A | 23S Ribosomal RNA |
1B 2B | 5S Ribosomal RNA |
1D 2D | 50S ribosomal protein L2 | RL2_THET8 1-276
1E 2E | 50S ribosomal protein L3 | RL3_THET8 1-206
1F 2F | 50S ribosomal protein L4 | RL4_THET8 1-210
1G 2G | 50S ribosomal protein L5 | RL5_THET8 1-182
1H 2H | 50S ribosomal protein L6 | RL6_THET8 1-180
1I 2I | 50S ribosomal protein L9 | RL9_THET8 1-148
1N 2N | 50S ribosomal protein L13 | RL13_THET8 1-140
1O 2O | 50S ribosomal protein L14 | RL14_THET8 1-122
1P 2P | 50S ribosomal protein L15 | RL15_THET8 1-150
1Q 2Q | 50S ribosomal protein L16 | RL16_THET8 1-141
1R 2R | 50S ribosomal protein L17 | RL17_THET8 1-118
1S 2S | 50S ribosomal protein L18 | RL18_THET8 1-112
1T 2T | 50S ribosomal protein L19 | RL19_THET8 1-146
1U 2U | 50S ribosomal protein L20 | RL20_THET8 1-118
1V 2V | 50S ribosomal protein L21 | RL21_THET8 1-101
1W 2W | 50S ribosomal protein L22 | RL22_THET8 1-113
1X 2X | 50S ribosomal protein L23 | RL23_THET8 1-96
1Y 2Y | 50S ribosomal protein L24 | RL24_THET8 1-110
1Z 2Z | 50S ribosomal protein L25 | RL25_THET8 1-206
1a 2a | 16S Ribosomal RNA |
1b 2b | 30S ribosomal protein S2 | RS2_THET8 1-256
1c 2c | 30S ribosomal protein S3 | RS3_THET8 1-239
1d 2d | 30S ribosomal protein S4 | RS4_THET8 1-209
1e 2e | 30S ribosomal protein S5 | RS5_THET8 1-162
1f 2f | 30S ribosomal protein S6 | RS6_THET8 1-101
1g 2g | 30S ribosomal protein S7 | RS7_THET8 1-156
1h 2h | 30S ribosomal protein S8 | RS8_THET8 1-138
1i 2i | 30S ribosomal protein S9 | RS9_THET8 1-128
1j 2j | 30S ribosomal protein S10 | RS10_THET8 1-105
1k 2k | 30S ribosomal protein S11 | RS11_THET8 1-129
1l 2l | 30S ribosomal protein S12 | RS12_THET8 4-135
1m 2m | 30S ribosomal protein S13 | RS13_THET8 1-126
1n 2n | 30S ribosomal protein S14 type Z | RS14Z_THET8 1-61
1o 2o | 30S ribosomal protein S15 | RS15_THET8 1-89
1p 2p | 30S ribosomal protein S16 | RS16_THET8 1-88
1q 2q | 30S ribosomal protein S17 | RS17_THET8 1-105
1r 2r | 30S ribosomal protein S18 | RS18_THET8 1-88
1s 2s | 30S ribosomal protein S19 | RS19_THET8 1-93
1t 2t | 30S ribosomal protein S20 | RS20_THET8 1-106
1u 2u | 30S ribosomal protein Thx | RSHX_THET8 1-27
1v 2v | mRNA |
1w 1y 2w 2y | A-site and E-site tRNAs |
1x 2x | P-site tRNA |
Non-standard residues in 4y4p #3
---
K — potassium ion
MG — magnesium ion
SF4 — iron/sulfur cluster
ZN — zinc ion
4y4p mmCIF Assemblies
---
1| author_defined_assembly
2| author_defined_assembly
> ui tool show "Show Sequence Viewer"
> sequence chain /1A /2A
Alignment identifier is 1
Could not find virtual screen for QCocoaScreen(0x600000c96d60, "Avedisian 495J
(AirPlay)", QRect(0,0 1920x1080), dpr=1, displayId=3, <NSScreen:
0x600001f0bcc0>) with displayId 3
> ui mousemode right select
> select /1A:2034/2A:2012
46 atoms, 50 bonds, 2 residues, 1 model selected
> select /1A:2034/2A:2012
46 atoms, 50 bonds, 2 residues, 1 model selected
> select sequence ttcgtcctgccacgggtaggccg
Nothing selected
> select sequence uucguccugcca
Nothing selected
> select sequence caggacgaaaa
482 atoms, 542 bonds, 22 residues, 1 model selected
> select /1A:2080/2A:2058
44 atoms, 48 bonds, 2 residues, 1 model selected
> select /1A:2080/2A:2058
44 atoms, 48 bonds, 2 residues, 1 model selected
Drag select of One 70S subunit.stl, One 70S subunit.stl, 300910 atoms, 16561
pseudobonds, 24 bonds
> hide sel atoms
> show sel cartoons
> select /1A:2142/2A:2120
46 atoms, 50 bonds, 2 residues, 1 model selected
> select /1A:2142/2A:2120
46 atoms, 50 bonds, 2 residues, 1 model selected
> select /B:2058
Nothing selected
> select /1A:2081/2A:2059
44 atoms, 48 bonds, 2 residues, 1 model selected
> select /1A:2080-2081/2A:2058-2059
88 atoms, 98 bonds, 4 residues, 1 model selected
> select /1A:2080/2A:2058
44 atoms, 48 bonds, 2 residues, 1 model selected
> select /1A:2080/2A:2058
44 atoms, 48 bonds, 2 residues, 1 model selected
> style sel sphere
Changed 44 atom styles
> color sel magenta
> ui mousemode right translate
> show sel atoms
> ui tool show "Basic Actions"
Could not find virtual screen for QCocoaScreen(0x600000c96d60, "Avedisian 495J
(AirPlay)", QRect(0,0 1920x1080), dpr=1, displayId=3, <NSScreen:
0x600001e445a0>) with displayId 3
[Repeated 1 time(s)]
> ui mousemode right select
Drag select of One 70S subunit.stl, 887432 of 3182520 triangles, One 70S
subunit.stl, 887432 of 3182520 triangles, 16 atoms, 13499 residues, 20
pseudobonds
> select /1A
65232 atoms, 69269 bonds, 5958 pseudobonds, 6251 residues, 4 models selected
> select /2A
62621 atoms, 67553 bonds, 4859 pseudobonds, 5099 residues, 4 models selected
> hide sel atoms
> hide sel cartoons
Drag select of 6845 residues, 6 pseudobonds
> hide sel cartoons
Drag select of One 70S subunit.stl, 1835310 of 3182520 triangles, One 70S
subunit.stl, 1835310 of 3182520 triangles, 6754 residues, 7 pseudobonds
Drag select of One 70S subunit.stl, 349739 of 3182520 triangles, One 70S
subunit.stl, 349739 of 3182520 triangles, 1008 residues
Drag select of One 70S subunit.stl, 44514 of 3182520 triangles, One 70S
subunit.stl, 44514 of 3182520 triangles, 490 residues
Drag select of 50 residues
Drag select of One 70S subunit.stl, 254527 of 3182520 triangles, One 70S
subunit.stl, 254527 of 3182520 triangles, 949 residues
> hide #1 models
> hide #2 models
Drag select of 5793 residues, 6 pseudobonds
> hide sel cartoons
Drag select of 2555 residues, 2 pseudobonds
> hide sel cartoons
Drag select of 1364 residues, 4 pseudobonds
> hide sel cartoons
Drag select of 477 residues
> hide sel cartoons
> ui mousemode right translate
> ui mousemode right select
Drag select of 376 residues
> hide sel cartoons
Drag select of 359 residues
> hide sel cartoons
Drag select of 4 residues
> hide sel cartoons
Drag select of 25 residues
> hide sel cartoons
> ui mousemode right translate
> show sel atoms
[Repeated 1 time(s)]
> hide sel atoms
> ui mousemode right select
Drag select of 16 atoms, 359 residues
> show sel atoms
> style sel stick
Changed 5868 atom styles
> style sel stick
Changed 5868 atom styles
> style sel stick
Changed 5868 atom styles
> style sel ball
Changed 5868 atom styles
> select :2058
43 atoms, 45 bonds, 3 residues, 1 model selected
> select :2080
46 atoms, 49 bonds, 3 residues, 1 model selected
> style sel sphere
Changed 46 atom styles
> select ~sel & ##selected
300864 atoms, 318647 bonds, 16561 pseudobonds, 28867 residues, 4 models
selected
> style sel stick
Changed 300864 atom styles
> select /2F
1600 atoms, 1615 bonds, 6 pseudobonds, 223 residues, 2 models selected
> select /1F
1605 atoms, 1619 bonds, 6 pseudobonds, 224 residues, 2 models selected
> select backbone
158945 atoms, 168189 bonds, 27 pseudobonds, 20959 residues, 2 models selected
> select protein
90996 atoms, 92543 bonds, 3 pseudobonds, 11574 residues, 2 models selected
> style sel sphere
Changed 90996 atom styles
> color (#!3 & sel) lime
> ui mousemode right translate
> ui mousemode right select
> select /1A:2080@C2
1 atom, 1 residue, 1 model selected
> select /1A:2080@N1
1 atom, 1 residue, 1 model selected
> select /1A:2080@C5
1 atom, 1 residue, 1 model selected
> select /1A:2080@C3'
1 atom, 1 residue, 1 model selected
> select :2080
46 atoms, 49 bonds, 3 residues, 1 model selected
> swapna :2080 U
> style sel stick
Changed 25 atom styles
> select :2080
41 atoms, 42 bonds, 3 residues, 1 model selected
> style sel stick
Changed 41 atom styles
> save /Users/abby/Desktop/Printing/feb10.cxs
——— End of log from Mon Feb 10 14:53:36 2025 ———
opened ChimeraX session
> open 4y4p format mmcif fromDatabase pdb
4y4p title:
Crystal structure of the Thermus thermophilus 70S ribosome with rRNA
modifications and bound to mRNA and A-, P- and E-site tRNAs at 2.5A resolution
[more info...]
Chain information for 4y4p #4
---
Chain | Description | UniProt
10 20 | 50S ribosomal protein L27 | RL27_THET8 1-85
11 21 | 50S ribosomal protein L28 | RL28_THET8 1-98
12 22 | 50S ribosomal protein L29 | RL29_THET8 1-72
13 23 | 50S ribosomal protein L30 | RL30_THET8 1-60
14 24 | 50S ribosomal protein L31 | RL31_THET8 1-71
15 25 | 50S ribosomal protein L32 | RL32_THET8 1-60
16 26 | 50S ribosomal protein L33 | RL33_THET8 1-54
17 27 | 50S ribosomal protein L34 | RL34_THET8 1-49
18 28 | 50S ribosomal protein L35 | RL35_THET8 1-65
19 29 | 50S ribosomal protein L36 | RL36_THET8 1-37
1A 2A | 23S Ribosomal RNA |
1B 2B | 5S Ribosomal RNA |
1D 2D | 50S ribosomal protein L2 | RL2_THET8 1-276
1E 2E | 50S ribosomal protein L3 | RL3_THET8 1-206
1F 2F | 50S ribosomal protein L4 | RL4_THET8 1-210
1G 2G | 50S ribosomal protein L5 | RL5_THET8 1-182
1H 2H | 50S ribosomal protein L6 | RL6_THET8 1-180
1I 2I | 50S ribosomal protein L9 | RL9_THET8 1-148
1N 2N | 50S ribosomal protein L13 | RL13_THET8 1-140
1O 2O | 50S ribosomal protein L14 | RL14_THET8 1-122
1P 2P | 50S ribosomal protein L15 | RL15_THET8 1-150
1Q 2Q | 50S ribosomal protein L16 | RL16_THET8 1-141
1R 2R | 50S ribosomal protein L17 | RL17_THET8 1-118
1S 2S | 50S ribosomal protein L18 | RL18_THET8 1-112
1T 2T | 50S ribosomal protein L19 | RL19_THET8 1-146
1U 2U | 50S ribosomal protein L20 | RL20_THET8 1-118
1V 2V | 50S ribosomal protein L21 | RL21_THET8 1-101
1W 2W | 50S ribosomal protein L22 | RL22_THET8 1-113
1X 2X | 50S ribosomal protein L23 | RL23_THET8 1-96
1Y 2Y | 50S ribosomal protein L24 | RL24_THET8 1-110
1Z 2Z | 50S ribosomal protein L25 | RL25_THET8 1-206
1a 2a | 16S Ribosomal RNA |
1b 2b | 30S ribosomal protein S2 | RS2_THET8 1-256
1c 2c | 30S ribosomal protein S3 | RS3_THET8 1-239
1d 2d | 30S ribosomal protein S4 | RS4_THET8 1-209
1e 2e | 30S ribosomal protein S5 | RS5_THET8 1-162
1f 2f | 30S ribosomal protein S6 | RS6_THET8 1-101
1g 2g | 30S ribosomal protein S7 | RS7_THET8 1-156
1h 2h | 30S ribosomal protein S8 | RS8_THET8 1-138
1i 2i | 30S ribosomal protein S9 | RS9_THET8 1-128
1j 2j | 30S ribosomal protein S10 | RS10_THET8 1-105
1k 2k | 30S ribosomal protein S11 | RS11_THET8 1-129
1l 2l | 30S ribosomal protein S12 | RS12_THET8 4-135
1m 2m | 30S ribosomal protein S13 | RS13_THET8 1-126
1n 2n | 30S ribosomal protein S14 type Z | RS14Z_THET8 1-61
1o 2o | 30S ribosomal protein S15 | RS15_THET8 1-89
1p 2p | 30S ribosomal protein S16 | RS16_THET8 1-88
1q 2q | 30S ribosomal protein S17 | RS17_THET8 1-105
1r 2r | 30S ribosomal protein S18 | RS18_THET8 1-88
1s 2s | 30S ribosomal protein S19 | RS19_THET8 1-93
1t 2t | 30S ribosomal protein S20 | RS20_THET8 1-106
1u 2u | 30S ribosomal protein Thx | RSHX_THET8 1-27
1v 2v | mRNA |
1w 1y 2w 2y | A-site and E-site tRNAs |
1x 2x | P-site tRNA |
Non-standard residues in 4y4p #4
---
K — potassium ion
MG — magnesium ion
SF4 — iron/sulfur cluster
ZN — zinc ion
4y4p mmCIF Assemblies
---
1| author_defined_assembly
2| author_defined_assembly
> ui mousemode right select
Drag select of 146059 atoms, 7506 pseudobonds, 12 bonds
> hide sel cartoons
> hide sel atoms
Drag select of 90 atoms, 3 pseudobonds
Drag select of 557 atoms, 6 pseudobonds
> hide sel atoms
Drag select of 393 atoms
> hide sel atoms
Drag select of 131 atoms, 7 pseudobonds
> show sel cartoons
Drag select of 157971 atoms, 374 residues, 9169 pseudobonds, 3826 bonds
> hide sel cartoons
[Repeated 1 time(s)]
> show sel cartoons
> hide sel atoms
Drag select of 15 residues
> hide sel atoms
> hide sel cartoons
Drag select of 187 residues
> ui mousemode right translate
> ui mousemode right select
Drag select of 13 residues
> hide sel atoms
> hide sel cartoons
Drag select of 2 residues
> hide sel cartoons
Drag select of 110 residues
> hide sel cartoons
Drag select of 1 residues
> hide sel cartoons
Drag select of 32 residues
> hide sel cartoons
Drag select of 2 residues
> hide sel cartoons
> ui mousemode right translate
> ui mousemode right select
Drag select of 38 residues, 1 pseudobonds
> hide sel cartoons
Drag select of 9 residues
> hide sel cartoons
Drag select of 1 residues
> hide sel cartoons
Drag select of 5 residues
> hide sel cartoons
> ui mousemode right translate
> ui mousemode right select
Drag select of 10864 residues, 13 pseudobonds
> select clear
> save /Users/abby/Desktop/Printing/ribosome.cxs
> select #3/1a#3/2a#4/1a#4/2a
131722 atoms, 144558 bonds, 8380 pseudobonds, 8582 residues, 8 models selected
> show sel surfaces
> hide sel surfaces
> select #3/1a
32913 atoms, 36094 bonds, 2127 pseudobonds, 2167 residues, 4 models selected
> select #3/2a
32948 atoms, 36185 bonds, 2063 pseudobonds, 2124 residues, 4 models selected
> select #4/1a
32913 atoms, 36094 bonds, 2127 pseudobonds, 2167 residues, 4 models selected
> show sel surfaces
> color (#!4 & sel) yellow
> color (#!4 & sel) cornflower blue
> select #4/2a
32948 atoms, 36185 bonds, 2063 pseudobonds, 2124 residues, 4 models selected
> select #4/1A
65232 atoms, 69269 bonds, 5958 pseudobonds, 6251 residues, 4 models selected
> show sel surfaces
> color (#!4 & sel) hot pink
> select /30S & protein
Nothing selected
> select :.A-D & protein
Expected an objects specifier or a keyword
> select :.A-U & protein
Expected an objects specifier or a keyword
> select /1j
1418 atoms, 1444 bonds, 194 residues, 2 models selected
> select /1j, 1l, 1k
4962 atoms, 5028 bonds, 16 pseudobonds, 688 residues, 4 models selected
> select /1j, 1l, 1k, 1m, 1n, 1o, 1p, 1q, 1r, 1s, 1t, 1u, 1b, 1c, 1d, 1e, 1f,
> 1g, 1h, 1i
37242 atoms, 37788 bonds, 58 pseudobonds, 4810 residues, 4 models selected
> show sel surfaces
> color (#!3-4 & sel) medium blue
> select /1N, 1O, 1P, 1Q, 1R, 1S, 1T
14698 atoms, 14704 bonds, 78 pseudobonds, 2042 residues, 4 models selected
> select /1N, 1O, 1P, 1Q, 1R, 1S, 1T, 1D, 1U, 1V, 1W, 1X, 1Y, 1Z, 10, 11, 12,
> 1E, 13, 14, 15, 16, 17, 18, 19, 1F, 1G, 1H, 1I
54670 atoms, 54828 bonds, 324 pseudobonds, 7612 residues, 6 models selected
> color (#!3-4 & sel) magenta
> color (#!3-4 & sel) purple
> show sel surfaces
Drag select of 4y4p_1D SES surface, 22597 of 284764 triangles, 4y4p_1H SES
surface, 2763 of 171312 triangles, 4y4p_1O SES surface, 933 of 111516
triangles, 4y4p_1Q SES surface, 103 of 153580 triangles, 4y4p_1A SES surface,
163005 of 7319130 triangles, 4y4p_1D SES surface, 22597 of 284764 triangles,
4y4p_1H SES surface, 2763 of 171312 triangles, 4y4p_1O SES surface, 933 of
111516 triangles, 4y4p_1Q SES surface, 103 of 153580 triangles, 183 residues,
1 pseudobonds
Drag select of 4y4p_1f SES surface, 5 of 112428 triangles, 4y4p_1o SES
surface, 1271 of 103486 triangles, 4y4p_1O SES surface, 13712 of 111516
triangles, 4y4p_1a SES surface, 67982 of 3871982 triangles, 4y4p_1A SES
surface, 45443 of 7319130 triangles, 4y4p_1f SES surface, 5 of 112428
triangles, 4y4p_1o SES surface, 1271 of 103486 triangles, 4y4p_1O SES surface,
13712 of 111516 triangles, 95 residues
> ui mousemode right translate
> select #4/1B
2682 atoms, 2882 bonds, 210 pseudobonds, 225 residues, 3 models selected
> show sel surfaces
> color (#!4 & sel) cyan
> color (#!4 & sel) lime
> select #3/1w#3/1y#3/2w#3/2y#4/1w#4/1y#4/2w#4/2y
12718 atoms, 14034 bonds, 670 pseudobonds, 732 residues, 8 models selected
> color (#!3-4 & sel) yellow
> select #3/1x#3/2x#4/1x#4/2x
6586 atoms, 7260 bonds, 352 pseudobonds, 390 residues, 6 models selected
> color (#!3-4 & sel) orange
> color (#!3-4 & sel) orange red
> select #3/1v#3/2v#4/1v#4/2v
1126 atoms, 1240 bonds, 2 pseudobonds, 70 residues, 4 models selected
> color (#!3-4 & sel) black
> save /Users/abby/Desktop/Printing/ribosome_subunits_colored.cxs
——— End of log from Sun Feb 23 20:08:11 2025 ———
opened ChimeraX session
> select #3/1w#3/1y#3/2w#3/2y#4/1w#4/1y#4/2w#4/2y
12718 atoms, 14034 bonds, 670 pseudobonds, 732 residues, 8 models selected
> select #4/2w
1554 atoms, 1723 bonds, 75 pseudobonds, 82 residues, 4 models selected
> select #3/1w
1624 atoms, 1777 bonds, 92 pseudobonds, 106 residues, 4 models selected
> select #3/1y
1590 atoms, 1770 bonds, 83 pseudobonds, 79 residues, 4 models selected
> select #3/2w
1554 atoms, 1723 bonds, 75 pseudobonds, 82 residues, 4 models selected
> select #3/2y
1591 atoms, 1747 bonds, 85 pseudobonds, 99 residues, 4 models selected
> select #4/1w
1624 atoms, 1777 bonds, 92 pseudobonds, 106 residues, 4 models selected
> select #4/1y
1590 atoms, 1770 bonds, 83 pseudobonds, 79 residues, 4 models selected
> select #4/2y
1591 atoms, 1747 bonds, 85 pseudobonds, 99 residues, 4 models selected
> select #4/2w
1554 atoms, 1723 bonds, 75 pseudobonds, 82 residues, 4 models selected
> ui mousemode right select
> select #4/1w:48
20 atoms, 21 bonds, 1 residue, 1 model selected
> select #3/1x#3/2x#4/1x#4/2x
6586 atoms, 7260 bonds, 352 pseudobonds, 390 residues, 6 models selected
> select #4/1x
1656 atoms, 1815 bonds, 96 pseudobonds, 107 residues, 3 models selected
> select #4/2x
1637 atoms, 1815 bonds, 80 pseudobonds, 88 residues, 3 models selected
> select #3/2x
1637 atoms, 1815 bonds, 80 pseudobonds, 88 residues, 3 models selected
> select #3/1x
1656 atoms, 1815 bonds, 96 pseudobonds, 107 residues, 3 models selected
Drag select of 4y4p_16 SES surface, 2127 of 60674 triangles, 4y4p_16 SES
surface, 2127 of 60674 triangles, 40 residues
Drag select of 40 residues
Drag select of 4y4p_16 SES surface, 3007 of 60674 triangles, 4y4p_1G SES
surface, 599 of 173586 triangles, 4y4p_16 SES surface, 3007 of 60674
triangles, 4y4p_1G SES surface, 599 of 173586 triangles, 27 residues
> select #3/1w#3/1y#3/2w#3/2y#4/1w#4/1y#4/2w#4/2y
12718 atoms, 14034 bonds, 670 pseudobonds, 732 residues, 8 models selected
> hide sel cartoons
> show sel cartoons
> hide sel atoms
> hide sel cartoons
> show sel cartoons
> style sel sphere
Changed 12718 atom styles
> style sel sphere
Changed 12718 atom styles
> hide sel cartoons
> show sel cartoons
> hide sel atoms
> show sel atoms
> color (#!3-4 & sel) byelement
> ui mousemode right translate
> ui mousemode right select
Drag select of 3966 atoms, 260 residues, 280 pseudobonds
Drag select of 4y4p_1P SES surface, 6573 of 187632 triangles, 4y4p_1S SES
surface, 349 of 109936 triangles, 4y4p_1P SES surface, 6573 of 187632
triangles, 4y4p_1S SES surface, 349 of 109936 triangles, 4500 atoms, 293
residues, 316 pseudobonds
> hide sel atoms
> hide sel cartoons
> select clear
[Repeated 1 time(s)]
> hide atoms
> show cartoons
> undo
Drag select of 2 residues
> select #3/1w#3/1y#3/2w#3/2y#4/1w#4/1y#4/2w#4/2y
12718 atoms, 14034 bonds, 670 pseudobonds, 732 residues, 8 models selected
> style sel sphere
Changed 12718 atom styles
> show sel cartoons
> show sel atoms
Drag select of 1742 atoms, 122 residues, 110 pseudobonds
Drag select of 1248 atoms, 92 residues, 76 pseudobonds
Drag select of 532 atoms, 40 residues, 14 pseudobonds
Drag select of 226 atoms, 14 residues
Drag select of 96 atoms, 10 residues
> ui mousemode right translate
> ui mousemode right select
Drag select of 4548 atoms, 290 residues, 320 pseudobonds
> save "/Users/abby/Desktop/Printing/ribosome tRNA sphere.cxs"
——— End of log from Mon Feb 24 14:16:52 2025 ———
opened ChimeraX session
> ui mousemode right translate
> ui mousemode right select
Drag select of 4y4p_1P SES surface, 1758 of 187632 triangles, 4y4p_1P SES
surface, 1758 of 187632 triangles, 4322 atoms, 283 residues, 302 pseudobonds
Drag select of 4548 atoms, 290 residues, 320 pseudobonds
> hide sel atoms
> hide sel cartoons
> ui mousemode right translate
> select #4/1B
2682 atoms, 2882 bonds, 210 pseudobonds, 225 residues, 3 models selected
> color (#!4 & sel) hot pink
> save "/Users/abby/Desktop/Printing/ribosome tRNA sphere.cxs"
> ui mousemode right select
> select clear
> save /Users/abby/Desktop/Printing/2.24.cxs
——— End of log from Mon Feb 24 14:46:23 2025 ———
opened ChimeraX session
> select #3/1w#3/1y#3/2w#3/2y#4/1w#4/1y#4/2w#4/2y
12718 atoms, 14034 bonds, 670 pseudobonds, 732 residues, 8 models selected
> ui tool show "Basic Actions"
> setattr ribbon scaling 2
Unknown attribute target: 'ribbon'
> setattr ribbon xSectionWidth 2
Unknown attribute target: 'ribbon'
> setattr ribbon xSectionHeight 2
Unknown attribute target: 'ribbon'
> setattr cartoon scaling 2
Unknown attribute target: 'cartoon'
> setattr ribbon scaling 2
Unknown attribute target: 'ribbon'
> ribbon scale 2
> cartoon scale 2
Expected an atoms specifier or a keyword
> ribbon scale 2
> cartoon scale 2
Expected an atoms specifier or a keyword
> cartoon width 2
Expected an atoms specifier or a keyword
> help cartoon
> cartoon style width 1.5 thickness 0.3
> cartoon style width 2 thickness 2
> cartoon style width 3 thickness 3
> cartoon style width 5 thickness 3
> cartoon style width 3 thickness 2
> save /Users/abby/Desktop/Printing/2.24.cxs
——— End of log from Mon Feb 24 15:23:30 2025 ———
opened ChimeraX session
> close session
> open 3CS9 format mmcif fromDatabase pdb
3cs9 title:
Human ABL kinase in complex with nilotinib [more info...]
Chain information for 3cs9 #1
---
Chain | Description | UniProt
A B C D | Proto-oncogene tyrosine-protein kinase ABL1 | ABL1_HUMAN 229-500
Non-standard residues in 3cs9 #1
---
NIL — Nilotinib
(4-methyl-N-[3-(4-methyl-1H-imidazol-1-yl)-5-(trifluoromethyl)phenyl]-3-[(4-pyridin-3-ylpyrimidin-2-yl)amino]benzamide)
3cs9 mmCIF Assemblies
---
1| author_and_software_defined_assembly
2| author_and_software_defined_assembly
3| author_and_software_defined_assembly
4| author_and_software_defined_assembly
12 atoms have alternate locations. Control/examine alternate locations with
Altloc Explorer [start tool...] or the altlocs command.
OpenGL version: 3.3.0 NVIDIA 576.40
OpenGL renderer: NVIDIA GeForce RTX 3070 Laptop GPU/PCIe/SSE2
OpenGL vendor: NVIDIA Corporation
Python: 3.11.4
Locale: en_US.cp1252
Qt version: PyQt6 6.7.1, Qt 6.7.1
Qt runtime version: 6.7.3
Qt platform: windows
Manufacturer: Alienware
Model: Alienware m17 R4
OS: Microsoft Windows 11 Enterprise (Build 26100)
Memory: 34,109,112,320
MaxProcessMemory: 137,438,953,344
CPU: 16 Intel(R) Core(TM) i9-10980HK CPU @ 2.40GHz
OSLanguage: en-US
Installed Packages:
alabaster: 1.0.0
anyio: 4.7.0
appdirs: 1.4.4
asttokens: 3.0.0
auditwheel: 6.1.0
babel: 2.16.0
beautifulsoup4: 4.12.3
blockdiag: 3.0.0
blosc2: 3.0.0
build: 1.2.1
certifi: 2024.8.30
cftime: 1.6.4.post1
charset-normalizer: 3.4.0
ChimeraX-AddCharge: 1.5.18
ChimeraX-AddH: 2.2.6
ChimeraX-AlignmentAlgorithms: 2.0.2
ChimeraX-AlignmentHdrs: 3.5
ChimeraX-AlignmentMatrices: 2.1
ChimeraX-Alignments: 2.16.1
ChimeraX-AlphaFold: 1.0.1
ChimeraX-AltlocExplorer: 1.1.2
ChimeraX-AmberInfo: 1.0
ChimeraX-Arrays: 1.1
ChimeraX-Atomic: 1.58.8
ChimeraX-AtomicLibrary: 14.1.11
ChimeraX-AtomSearch: 2.0.1
ChimeraX-AxesPlanes: 2.4
ChimeraX-BasicActions: 1.1.2
ChimeraX-BILD: 1.0
ChimeraX-BlastProtein: 3.0.0
ChimeraX-BondRot: 2.0.4
ChimeraX-BugReporter: 1.0.1
ChimeraX-BuildStructure: 2.13.1
ChimeraX-Bumps: 1.0
ChimeraX-BundleBuilder: 1.4.0
ChimeraX-ButtonPanel: 1.0.1
ChimeraX-CageBuilder: 1.0.1
ChimeraX-CellPack: 1.0
ChimeraX-Centroids: 1.4
ChimeraX-ChangeChains: 1.1
ChimeraX-CheckWaters: 1.4
ChimeraX-ChemGroup: 2.0.1
ChimeraX-Clashes: 2.3
ChimeraX-ColorActions: 1.0.5
ChimeraX-ColorGlobe: 1.0
ChimeraX-ColorKey: 1.5.6
ChimeraX-CommandLine: 1.2.5
ChimeraX-ConnectStructure: 2.0.1
ChimeraX-Contacts: 1.0.1
ChimeraX-Core: 1.9
ChimeraX-CoreFormats: 1.2
ChimeraX-coulombic: 1.4.4
ChimeraX-Crosslinks: 1.0
ChimeraX-Crystal: 1.0
ChimeraX-CrystalContacts: 1.0.1
ChimeraX-DataFormats: 1.2.3
ChimeraX-Dicom: 1.2.6
ChimeraX-DistMonitor: 1.4.2
ChimeraX-DockPrep: 1.1.3
ChimeraX-Dssp: 2.0
ChimeraX-EMDB-SFF: 1.0
ChimeraX-ESMFold: 1.0
ChimeraX-FileHistory: 1.0.1
ChimeraX-FunctionKey: 1.0.1
ChimeraX-Geometry: 1.3
ChimeraX-gltf: 1.0
ChimeraX-Graphics: 1.4.1
ChimeraX-Hbonds: 2.5
ChimeraX-Help: 1.3
ChimeraX-HKCage: 1.3
ChimeraX-IHM: 1.1
ChimeraX-ImageFormats: 1.2
ChimeraX-IMOD: 1.0
ChimeraX-IO: 1.0.3
ChimeraX-ItemsInspection: 1.0.1
ChimeraX-IUPAC: 1.0
ChimeraX-KVFinder: 1.2.1
ChimeraX-Label: 1.1.14
ChimeraX-ListInfo: 1.2.2
ChimeraX-Log: 1.2
ChimeraX-LookingGlass: 1.1
ChimeraX-Maestro: 1.9.1
ChimeraX-Map: 1.3
ChimeraX-MapData: 2.0
ChimeraX-MapEraser: 1.0.1
ChimeraX-MapFilter: 2.0.1
ChimeraX-MapFit: 2.0
ChimeraX-MapSeries: 2.1.1
ChimeraX-Markers: 1.0.1
ChimeraX-Mask: 1.0.2
ChimeraX-MatchMaker: 2.1.6
ChimeraX-MCopy: 1.0
ChimeraX-MDcrds: 2.7.2
ChimeraX-MedicalToolbar: 1.1
ChimeraX-Meeting: 1.0.1
ChimeraX-MLP: 1.1.1
ChimeraX-mmCIF: 2.14.2
ChimeraX-MMTF: 2.2
ChimeraX-ModelArchive: 1.0
ChimeraX-Modeller: 1.5.18
ChimeraX-ModelPanel: 1.5
ChimeraX-ModelSeries: 1.0.1
ChimeraX-Mol2: 2.0.3
ChimeraX-Mole: 1.0
ChimeraX-Morph: 1.0.2
ChimeraX-MouseModes: 1.2
ChimeraX-Movie: 1.0
ChimeraX-MutationScores: 1.0
ChimeraX-Neuron: 1.0
ChimeraX-Nifti: 1.2
ChimeraX-NMRSTAR: 1.0.2
ChimeraX-NRRD: 1.2
ChimeraX-Nucleotides: 2.0.3
ChimeraX-OpenCommand: 1.14
ChimeraX-OrthoPick: 1.0.1
ChimeraX-PDB: 2.7.6
ChimeraX-PDBBio: 1.0.1
ChimeraX-PDBLibrary: 1.0.4
ChimeraX-PDBMatrices: 1.0
ChimeraX-PickBlobs: 1.0.1
ChimeraX-Positions: 1.0
ChimeraX-PresetMgr: 1.1.2
ChimeraX-PubChem: 2.2
ChimeraX-ReadPbonds: 1.0.1
ChimeraX-Registration: 1.1.2
ChimeraX-RemoteControl: 1.0
ChimeraX-RenderByAttr: 1.6.2
ChimeraX-RenumberResidues: 1.1
ChimeraX-ResidueFit: 1.0.1
ChimeraX-RestServer: 1.3.1
ChimeraX-RNALayout: 1.0
ChimeraX-RotamerLibMgr: 4.0
ChimeraX-RotamerLibsDunbrack: 2.0
ChimeraX-RotamerLibsDynameomics: 2.0
ChimeraX-RotamerLibsRichardson: 2.0
ChimeraX-SaveCommand: 1.5.1
ChimeraX-SchemeMgr: 1.0
ChimeraX-SDF: 2.0.2
ChimeraX-Segger: 1.0
ChimeraX-Segment: 1.0.1
ChimeraX-Segmentations: 3.5.6
ChimeraX-SelInspector: 1.0
ChimeraX-SeqView: 2.14
ChimeraX-Shape: 1.0.1
ChimeraX-Shell: 1.0.1
ChimeraX-Shortcuts: 1.2.0
ChimeraX-ShowSequences: 1.0.3
ChimeraX-SideView: 1.0.1
ChimeraX-SimilarStructures: 1.0.1
ChimeraX-Smiles: 2.1.2
ChimeraX-SmoothLines: 1.0
ChimeraX-SpaceNavigator: 1.0
ChimeraX-StdCommands: 1.18.1
ChimeraX-STL: 1.0.1
ChimeraX-Storm: 1.0
ChimeraX-StructMeasure: 1.2.1
ChimeraX-Struts: 1.0.1
ChimeraX-Surface: 1.0.1
ChimeraX-SwapAA: 2.0.1
ChimeraX-SwapRes: 2.5
ChimeraX-TapeMeasure: 1.0
ChimeraX-TaskManager: 1.0
ChimeraX-Test: 1.0
ChimeraX-Toolbar: 1.2.3
ChimeraX-ToolshedUtils: 1.2.4
ChimeraX-Topography: 1.0
ChimeraX-ToQuest: 1.0
ChimeraX-Tug: 1.0.1
ChimeraX-UI: 1.41
ChimeraX-Umap: 1.0
ChimeraX-uniprot: 2.3.1
ChimeraX-UnitCell: 1.0.1
ChimeraX-ViewDockX: 1.4.4
ChimeraX-VIPERdb: 1.0
ChimeraX-Vive: 1.1
ChimeraX-VolumeMenu: 1.0.1
ChimeraX-vrml: 1.0
ChimeraX-VTK: 1.0
ChimeraX-WavefrontOBJ: 1.0
ChimeraX-WebCam: 1.0.2
ChimeraX-WebServices: 1.1.4
ChimeraX-Zone: 1.0.1
colorama: 0.4.6
comm: 0.2.2
comtypes: 1.4.5
contourpy: 1.3.1
cxservices: 1.2.3
cycler: 0.12.1
Cython: 3.0.10
debugpy: 1.8.9
decorator: 5.1.1
docutils: 0.21.2
executing: 2.1.0
filelock: 3.15.4
fonttools: 4.55.3
funcparserlib: 2.0.0a0
glfw: 2.8.0
grako: 3.16.5
h11: 0.14.0
h5py: 3.12.1
html2text: 2024.2.26
httpcore: 1.0.7
httpx: 0.28.1
idna: 3.10
ihm: 1.3
imagecodecs: 2024.6.1
imagesize: 1.4.1
ipykernel: 6.29.5
ipython: 8.26.0
ipywidgets: 8.1.5
jedi: 0.19.1
Jinja2: 3.1.4
jupyter_client: 8.6.2
jupyter_core: 5.7.2
jupyterlab_widgets: 3.0.13
kiwisolver: 1.4.7
line_profiler: 4.1.3
lxml: 5.2.2
lz4: 4.3.3
MarkupSafe: 3.0.2
matplotlib: 3.9.2
matplotlib-inline: 0.1.7
msgpack: 1.0.8
ndindex: 1.9.2
nest-asyncio: 1.6.0
netCDF4: 1.6.5
networkx: 3.3
nibabel: 5.2.0
nptyping: 2.5.0
numexpr: 2.10.2
numpy: 1.26.4
openvr: 1.26.701
packaging: 23.2
ParmEd: 4.2.2
parso: 0.8.4
pep517: 0.13.1
pillow: 10.4.0
pip: 24.2
pkginfo: 1.11.1
platformdirs: 4.3.6
prompt_toolkit: 3.0.48
psutil: 6.0.0
pure_eval: 0.2.3
py-cpuinfo: 9.0.0
pycollada: 0.8
pydicom: 2.4.4
pyelftools: 0.31
Pygments: 2.18.0
pynmrstar: 3.3.4
pynrrd: 1.0.0
PyOpenGL: 3.1.7
PyOpenGL-accelerate: 3.1.7
pyopenxr: 1.0.3401
pyparsing: 3.2.0
pyproject_hooks: 1.2.0
PyQt6-commercial: 6.7.1
PyQt6-Qt6: 6.7.3
PyQt6-WebEngine-commercial: 6.7.0
PyQt6-WebEngine-Qt6: 6.7.3
PyQt6-WebEngineSubwheel-Qt6: 6.7.3
PyQt6_sip: 13.8.0
python-dateutil: 2.9.0.post0
pytz: 2024.2
pywin32: 306
pyzmq: 26.2.0
qtconsole: 5.5.2
QtPy: 2.4.2
qtshim: 1.0
RandomWords: 0.4.0
requests: 2.32.3
scipy: 1.14.0
setuptools: 72.1.0
sfftk-rw: 0.8.1
six: 1.16.0
sniffio: 1.3.1
snowballstemmer: 2.2.0
sortedcontainers: 2.4.0
soupsieve: 2.6
Sphinx: 8.0.2
sphinx-autodoc-typehints: 2.2.3
sphinxcontrib-applehelp: 2.0.0
sphinxcontrib-blockdiag: 3.0.0
sphinxcontrib-devhelp: 2.0.0
sphinxcontrib-htmlhelp: 2.1.0
sphinxcontrib-jsmath: 1.0.1
sphinxcontrib-qthelp: 2.0.0
sphinxcontrib-serializinghtml: 2.0.0
stack-data: 0.6.3
superqt: 0.6.3
tables: 3.10.1
tcia_utils: 1.5.1
tifffile: 2024.7.24
tinyarray: 1.2.4
tornado: 6.4.2
traitlets: 5.14.3
typing_extensions: 4.12.2
tzdata: 2024.2
urllib3: 2.2.3
wcwidth: 0.2.13
webcolors: 24.6.0
wheel: 0.43.0
wheel-filename: 1.4.1
widgetsnbextension: 4.0.13
WMI: 1.5.1
Change History (6)
comment:1 by , 14 months ago
| Component: | Unassigned → Structure Prediction |
|---|---|
| Owner: | set to |
| Platform: | → all |
| Project: | → ChimeraX |
| Status: | new → assigned |
| Summary: | ChimeraX bug report submission → AlphaFold: update best model |
comment:2 by , 14 months ago
I guess what you are doing is changing the sequence in the ChimeraX AlphaFold Run Google Colab window then pressing the "play" button to rerun with the new sequence. Unfortunately does not expect you do that. Instead you would paste an altered sequence into the ChimeraX AlphaFold window (not the AlphaFold Run window) and press Predict. The AlphaFold Run window is just treated as output by ChimeraX. When you alter the sequence in the AlphaFold Run window and press the "play" button it works and it downloads the results as a zip file to ChimeraX but since it already downloaded previous results named results.zip it names the new download file "results (1).zip". But ChimeraX is not expecting this and unzips the old "results.zip" file to load the predicted structure, which just shows the same structure as the first AlphaFold run.
So the solution is you should paste the prediction sequence into the AlphaFold panel choosing Sequence menu option "Paste" and press Predict. Then after that prediction finishes you can edit the sequence and press Predict again. That will create a new ~/Downloads/ChimeraX/AlphaFold/prediction_N directory for the second run.
I should be able to make what you are doing work. If ChimeraX sees that results.zip was already downloaded and it gets another download then it can create a new prediction directory automatically. I'll try to make that change in the ChimeraX daily build. It is too late to put it in the ChimeraX 1.10 release candidate.
comment:3 by , 14 months ago
Not a problem. I doubt it's something that most people do, but we encountered it while teaching and found a workaround. Thank you for looking into it! -- Dr. Christopher L. Hemme RI-INBRE Molecular Informatics Core Director 495K Avedisian Hall 7 Greenhouse Rd University of Rhode Island Kingston, RI 02881 Phone: (401) 874-9862 Schedule a MIC Consultation <https://calendar.app.google/9P2P6FysbaNXWste9> RI-INBRE Molecular Informatics Core <https://web.uri.edu/riinbre/mic/> Find us at the Core Marketplace <https://coremarketplace.org/RRID:SCR_017685> On Mon, Jun 2, 2025 at 3:29 PM ChimeraX <ChimeraX-bugs-admin@cgl.ucsf.edu> wrote: > > > >
comment:4 by , 14 months ago
I think it will be easy to make reruns in the Colab window display the new results in ChimeraX. No one ever reported this problem but I bet others have run into it.
comment:5 by , 14 months ago
| Resolution: | → fixed |
|---|---|
| Status: | assigned → closed |
Fixed in 1.11 daily builds, not in 1.10.
I made ChimeraX put a second prediction in a new directory when changing the sequence in the Colab window and rerunning directly in Colab without resubmitting with the ChimeraX AlphaFold Predict button.
Unfortunately I then observed another bug where after you modify the sequence by hand in Colab, then ChimeraX is no longer able to change the sequence if you submit a new prediction using the Predict button. This seems to be some oddity of the Google Colab javascript web interface. So I still would recommend against directly running new predictions in the Colab window.
By the way I mostly recommend against using Colab at all and instead using the new ChimeraX Boltz prediction capability which runs on your own computer (Mac, Windows and Linux) and handles ligands and nucleic acids and proteins. Here's some info about ChimeraX Boltz prediction and a video
https://www.rbvi.ucsf.edu/chimerax/data/boltz-apr2025/boltz_help.html
comment:6 by , 14 months ago
Thank you! -- Dr. Christopher L. Hemme RI-INBRE Molecular Informatics Core Director 495K Avedisian Hall 7 Greenhouse Rd University of Rhode Island Kingston, RI 02881 Phone: (401) 874-9862 Schedule a MIC Consultation <https://calendar.app.google/9P2P6FysbaNXWste9> RI-INBRE Molecular Informatics Core <https://web.uri.edu/riinbre/mic/> Find us at the Core Marketplace <https://coremarketplace.org/RRID:SCR_017685> On Mon, Jun 2, 2025 at 8:12 PM ChimeraX <ChimeraX-bugs-admin@cgl.ucsf.edu> wrote: > > > > > > > > > > >
Reported by Chris Hemme