id summary reporter owner description type status priority milestone component version resolution keywords cc blockedby blocking notify_on_close platform project 9177 ChimeraX bug report submission chimerax-bug-report@… "{{{ The following bug report has been submitted: Platform: macOS-10.16-x86_64-i386-64bit ChimeraX Version: 1.6.1 (2023-05-09 17:57:07 UTC) Description Last time you used ChimeraX it crashed. Please describe steps that led to the crash here. Fatal Python error: Segmentation fault Current thread 0x00007ff85a19d340 (most recent call first): File ""/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/chimerax/ui/gui.py"", line 275 in event_loop File ""/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/chimerax/core/__main__.py"", line 892 in init File ""/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/site-packages/chimerax/core/__main__.py"", line 1043 in File ""/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/runpy.py"", line 87 in _run_code File ""/Applications/ChimeraX-1.6.1.app/Contents/Library/Frameworks/Python.framework/Versions/3.9/lib/python3.9/runpy.py"", line 197 in _run_module_as_main {""app_name"":""ChimeraX"",""timestamp"":""2023-06-12 11:46:26.00 -0400"",""app_version"":""1.6.1"",""slice_uuid"":""5df621ee-554e-36a8-b448-93b2334e5480"",""build_version"":""1.6.1.0"",""platform"":1,""bundleID"":""edu.ucsf.cgl.ChimeraX"",""share_with_app_devs"":0,""is_first_party"":0,""bug_type"":""309"",""os_version"":""macOS 13.3.1 (22E772610a)"",""roots_installed"":0,""name"":""ChimeraX"",""incident_id"":""AA6625D7-E4A8-42C1-BA33-6E1C390DA4BC""} { ""uptime"" : 250000, ""procRole"" : ""Background"", ""version"" : 2, ""userID"" : 501, ""deployVersion"" : 210, ""modelCode"" : ""MacBookPro15,2"", ""coalitionID"" : 53470, ""osVersion"" : { ""train"" : ""macOS 13.3.1"", ""build"" : ""22E772610a"", ""releaseType"" : ""User"" }, ""captureTime"" : ""2023-06-12 11:46:08.6262 -0400"", ""incident"" : ""AA6625D7-E4A8-42C1-BA33-6E1C390DA4BC"", ""pid"" : 56548, ""cpuType"" : ""X86-64"", ""roots_installed"" : 0, ""bug_type"" : ""309"", ""procLaunch"" : ""2023-06-08 16:56:00.2203 -0400"", ""procStartAbsTime"" : 220016427807714, ""procExitAbsTime"" : 259285065740758, ""procName"" : ""ChimeraX"", ""procPath"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/MacOS\/ChimeraX"", ""bundleInfo"" : {""CFBundleShortVersionString"":""1.6.1"",""CFBundleVersion"":""1.6.1.0"",""CFBundleIdentifier"":""edu.ucsf.cgl.ChimeraX""}, ""storeInfo"" : {""deviceIdentifierForVendor"":""AA534D71-249F-5C83-BDF8-8597525678D1"",""thirdParty"":true}, ""parentProc"" : ""launchd"", ""parentPid"" : 1, ""coalitionName"" : ""edu.ucsf.cgl.ChimeraX"", ""crashReporterKey"" : ""1E84C152-81FD-95B6-1AA7-65E94D64DF08"", ""throttleTimeout"" : 2147483647, ""codeSigningID"" : ""edu.ucsf.cgl.ChimeraX"", ""codeSigningTeamID"" : ""LWV8X224YF"", ""codeSigningFlags"" : 570491649, ""codeSigningValidationCategory"" : 6, ""codeSigningTrustLevel"" : 0, ""wakeTime"" : 9152, ""bridgeVersion"" : {""build"":""20P4252"",""train"":""7.4""}, ""sleepWakeUUID"" : ""E7DC04E2-54C4-46CA-AF59-0BE3F6C1F93B"", ""sip"" : ""enabled"", ""vmRegionInfo"" : ""0x18 is not in any region. Bytes before following region: 140737487937512\n REGION TYPE START - END [ VSIZE] PRT\/MAX SHRMOD REGION DETAIL\n UNUSED SPACE AT START\n---> \n shared memory 7ffffff9a000-7ffffff9b000 [ 4K] r-x\/r-x SM=SHM "", ""exception"" : {""codes"":""0x0000000000000001, 0x0000000000000018"",""rawCodes"":[1,24],""type"":""EXC_BAD_ACCESS"",""signal"":""SIGSEGV"",""subtype"":""KERN_INVALID_ADDRESS at 0x0000000000000018""}, ""vmregioninfo"" : ""0x18 is not in any region. Bytes before following region: 140737487937512\n REGION TYPE START - END [ VSIZE] PRT\/MAX SHRMOD REGION DETAIL\n UNUSED SPACE AT START\n---> \n shared memory 7ffffff9a000-7ffffff9b000 [ 4K] r-x\/r-x SM=SHM "", ""extMods"" : {""caller"":{""thread_create"":0,""thread_set_state"":0,""task_for_pid"":0},""system"":{""thread_create"":0,""thread_set_state"":0,""task_for_pid"":0},""targeted"":{""thread_create"":0,""thread_set_state"":0,""task_for_pid"":0},""warnings"":0}, ""faultingThread"" : 0, ""threads"" : [{""queue"":""com.apple.main-thread"",""instructionState"":{""instructionStream"":{""bytes"":[102,231,255,235,7,235,2,235,0,72,137,195,72,131,125,192,0,116,9,72,139,125,192,232,199,36,41,0,72,137,223,232,249,38,41,0,102,15,31,132,0,0,0,0,0,85,72,137,229,65,87,65,86,65,84,83,72,131,236,64,73,137,247,73,137,254,72,199,7,0,0,0,0,72,137,247,232,172,255,223,255,102,46,15,31,132,0,0,0,0,0,102,144,72,137,195,72,139,120,24,72,139,7,255,80,24,72,133,192,117,238,72,137,223,232,6,124,221,255,72,139,123,24,72,139,7,255,80,32,72,133,192,116,32,73,139,62,73,137,6,72,133,255,15,132,204,1,0,0,72,131,196,64,91,65,92,65,94,65,95,93,233,61,36,41,0,72,139,3,72,137,223,255,144,168,0,0,0,131,248,9,117,61,76,137,255,232,254,254,223,255,72],""offset"":96}},""frames"":[{""imageOffset"":33266,""symbol"":""__pthread_kill"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":24294,""symbol"":""pthread_kill"",""symbolLocation"":263,""imageIndex"":152},{""imageOffset"":271873,""symbol"":""raise"",""symbolLocation"":26,""imageIndex"":153},{""imageOffset"":13805,""symbol"":""_sigtramp"",""symbolLocation"":29,""imageIndex"":154},{""imageOffset"":0,""imageIndex"":155},{""imageOffset"":48058,""imageIndex"":69},{""imageOffset"":87816,""imageIndex"":69},{""imageOffset"":504101,""symbol"":""QCommonStyle::drawControl(QStyle::ControlElement, QStyleOption const*, QPainter*, QWidget const*) const"",""symbolLocation"":1845,""imageIndex"":48},{""imageOffset"":74236,""imageIndex"":69},{""imageOffset"":787163,""imageIndex"":48},{""imageOffset"":2137620,""symbol"":""QTabBar::paintEvent(QPaintEvent*)"",""symbolLocation"":1700,""imageIndex"":48},{""imageOffset"":372014,""symbol"":""QWidget::event(QEvent*)"",""symbolLocation"":1262,""imageIndex"":48},{""imageOffset"":2135124,""symbol"":""QTabBar::event(QEvent*)"",""symbolLocation"":980,""imageIndex"":48},{""imageOffset"":43463,""symbol"":""QApplicationPrivate::notify_helper(QObject*, QEvent*)"",""symbolLocation"":247,""imageIndex"":48},{""imageOffset"":47372,""symbol"":""QApplication::notify(QObject*, QEvent*)"",""symbolLocation"":508,""imageIndex"":48},{""imageOffset"":1282438,""symbol"":""sipQApplication::notify(QObject*, QEvent*)"",""symbolLocation"":230,""imageIndex"":47},{""imageOffset"":450858,""symbol"":""QCoreApplication::notifyInternal2(QObject*, QEvent*)"",""symbolLocation"":170,""imageIndex"":45},{""imageOffset"":315357,""symbol"":""QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":3981,""imageIndex"":48},{""imageOffset"":347167,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":1007,""imageIndex"":48},{""imageOffset"":315672,""symbol"":""QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":4296,""imageIndex"":48},{""imageOffset"":347167,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":1007,""imageIndex"":48},{""imageOffset"":315672,""symbol"":""QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":4296,""imageIndex"":48},{""imageOffset"":347167,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":1007,""imageIndex"":48},{""imageOffset"":315672,""symbol"":""QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":4296,""imageIndex"":48},{""imageOffset"":347167,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":1007,""imageIndex"":48},{""imageOffset"":315672,""symbol"":""QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":4296,""imageIndex"":48},{""imageOffset"":347167,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":1007,""imageIndex"":48},{""imageOffset"":346842,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":682,""imageIndex"":48},{""imageOffset"":346842,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":682,""imageIndex"":48},{""imageOffset"":346842,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":682,""imageIndex"":48},{""imageOffset"":346842,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":682,""imageIndex"":48},{""imageOffset"":346842,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":682,""imageIndex"":48},{""imageOffset"":346842,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":682,""imageIndex"":48},{""imageOffset"":346842,""symbol"":""QWidgetPrivate::paintSiblingsRecursive(QPaintDevice*, QList const&, int, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":682,""imageIndex"":48},{""imageOffset"":315672,""symbol"":""QWidgetPrivate::drawWidget(QPaintDevice*, QRegion const&, QPoint const&, QFlags, QPainter*, QWidgetRepaintManager*)"",""symbolLocation"":4296,""imageIndex"":48},{""imageOffset"":446749,""symbol"":""QWidgetRepaintManager::paintAndFlush()"",""symbolLocation"":5085,""imageIndex"":48},{""imageOffset"":447487,""symbol"":""QWidgetRepaintManager::sync()"",""symbolLocation"":255,""imageIndex"":48},{""imageOffset"":372565,""symbol"":""QWidget::event(QEvent*)"",""symbolLocation"":1813,""imageIndex"":48},{""imageOffset"":1679844,""symbol"":""QMainWindow::event(QEvent*)"",""symbolLocation"":276,""imageIndex"":48},{""imageOffset"":612367,""symbol"":""sipQMainWindow::event(QEvent*)"",""symbolLocation"":191,""imageIndex"":47},{""imageOffset"":43463,""symbol"":""QApplicationPrivate::notify_helper(QObject*, QEvent*)"",""symbolLocation"":247,""imageIndex"":48},{""imageOffset"":47372,""symbol"":""QApplication::notify(QObject*, QEvent*)"",""symbolLocation"":508,""imageIndex"":48},{""imageOffset"":1282438,""symbol"":""sipQApplication::notify(QObject*, QEvent*)"",""symbolLocation"":230,""imageIndex"":47},{""imageOffset"":450858,""symbol"":""QCoreApplication::notifyInternal2(QObject*, QEvent*)"",""symbolLocation"":170,""imageIndex"":45},{""imageOffset"":431989,""symbol"":""QWidgetRepaintManager::sendUpdateRequest(QWidget*, QWidgetRepaintManager::UpdateTime)"",""symbolLocation"":629,""imageIndex"":48},{""imageOffset"":431267,""symbol"":""void QWidgetRepaintManager::markDirty(QRect const&, QWidget*, QWidgetRepaintManager::UpdateTime, QWidgetRepaintManager::BufferState)"",""symbolLocation"":2163,""imageIndex"":48},{""imageOffset"":475377,""imageIndex"":48},{""imageOffset"":775594,""imageIndex"":45},{""imageOffset"":855085,""symbol"":""QWindowPrivate::emitScreenChangedRecursion(QScreen*)"",""symbolLocation"":77,""imageIndex"":49},{""imageOffset"":813514,""symbol"":""QScreen::~QScreen()"",""symbolLocation"":682,""imageIndex"":49},{""imageOffset"":813630,""symbol"":""QScreen::~QScreen()"",""symbolLocation"":14,""imageIndex"":49},{""imageOffset"":895932,""symbol"":""QWindowSystemInterface::handleScreenRemoved(QPlatformScreen*)"",""symbolLocation"":28,""imageIndex"":49},{""imageOffset"":211027,""imageIndex"":68},{""imageOffset"":203752,""imageIndex"":68},{""imageOffset"":227502,""imageIndex"":68},{""imageOffset"":86925,""symbol"":""displayConfigFinalizedProc"",""symbolLocation"":259,""imageIndex"":156},{""imageOffset"":46273,""symbol"":""CGSPostLocalNotification"",""symbolLocation"":220,""imageIndex"":156},{""imageOffset"":45012,""symbol"":""(anonymous namespace)::notify_datagram_handler(unsigned int, CGSDatagramType, void*, unsigned long, void*)"",""symbolLocation"":98,""imageIndex"":156},{""imageOffset"":3312444,""symbol"":""CGSDatagramReadStream::dispatchMainQueueDatagrams()"",""symbolLocation"":202,""imageIndex"":156},{""imageOffset"":3312227,""symbol"":""invocation function for block in CGSDatagramReadStream::mainQueueWakeup()"",""symbolLocation"":18,""imageIndex"":156},{""imageOffset"":7569,""symbol"":""_dispatch_call_block_and_release"",""symbolLocation"":12,""imageIndex"":157},{""imageOffset"":12339,""symbol"":""_dispatch_client_callout"",""symbolLocation"":8,""imageIndex"":157},{""imageOffset"":65487,""symbol"":""_dispatch_main_queue_drain"",""symbolLocation"":954,""imageIndex"":157},{""imageOffset"":64519,""symbol"":""_dispatch_main_queue_callback_4CF"",""symbolLocation"":31,""imageIndex"":157},{""imageOffset"":770613,""symbol"":""__CFRUNLOOP_IS_SERVICING_THE_MAIN_DISPATCH_QUEUE__"",""symbolLocation"":9,""imageIndex"":158},{""imageOffset"":508015,""symbol"":""__CFRunLoopRun"",""symbolLocation"":2452,""imageIndex"":158},{""imageOffset"":503921,""symbol"":""CFRunLoopRunSpecific"",""symbolLocation"":560,""imageIndex"":158},{""imageOffset"":192461,""symbol"":""RunCurrentEventLoopInMode"",""symbolLocation"":292,""imageIndex"":159},{""imageOffset"":191966,""symbol"":""ReceiveNextEventCommon"",""symbolLocation"":657,""imageIndex"":159},{""imageOffset"":191288,""symbol"":""_BlockUntilNextEventMatchingListInModeWithFilter"",""symbolLocation"":64,""imageIndex"":159},{""imageOffset"":255904,""symbol"":""_DPSNextEvent"",""symbolLocation"":858,""imageIndex"":160},{""imageOffset"":251466,""symbol"":""-[NSApplication(NSEvent) _nextEventMatchingEventMask:untilDate:inMode:dequeue:]"",""symbolLocation"":1214,""imageIndex"":160},{""imageOffset"":195768,""symbol"":""-[NSApplication run]"",""symbolLocation"":586,""imageIndex"":160},{""imageOffset"":91987,""imageIndex"":68},{""imageOffset"":488630,""symbol"":""QEventLoop::exec(QFlags)"",""symbolLocation"":486,""imageIndex"":45},{""imageOffset"":452389,""symbol"":""QCoreApplication::exec()"",""symbolLocation"":133,""imageIndex"":45},{""imageOffset"":2250058,""symbol"":""meth_QApplication_exec(_object*, _object*)"",""symbolLocation"":90,""imageIndex"":47},{""imageOffset"":517917,""symbol"":""cfunction_call"",""symbolLocation"":125,""imageIndex"":1},{""imageOffset"":259511,""symbol"":""_PyObject_MakeTpCall"",""symbolLocation"":359,""imageIndex"":1},{""imageOffset"":1146524,""symbol"":""call_function"",""symbolLocation"":876,""imageIndex"":1},{""imageOffset"":1135266,""symbol"":""_PyEval_EvalFrameDefault"",""symbolLocation"":25554,""imageIndex"":1},{""imageOffset"":261416,""symbol"":""function_code_fastcall"",""symbolLocation"":104,""imageIndex"":1},{""imageOffset"":269674,""symbol"":""method_vectorcall"",""symbolLocation"":202,""imageIndex"":1},{""imageOffset"":1146380,""symbol"":""call_function"",""symbolLocation"":732,""imageIndex"":1},{""imageOffset"":1135266,""symbol"":""_PyEval_EvalFrameDefault"",""symbolLocation"":25554,""imageIndex"":1},{""imageOffset"":1149699,""symbol"":""_PyEval_EvalCode"",""symbolLocation"":2611,""imageIndex"":1},{""imageOffset"":261297,""symbol"":""_PyFunction_Vectorcall"",""symbolLocation"":289,""imageIndex"":1},{""imageOffset"":1146380,""symbol"":""call_function"",""symbolLocation"":732,""imageIndex"":1},{""imageOffset"":1135435,""symbol"":""_PyEval_EvalFrameDefault"",""symbolLocation"":25723,""imageIndex"":1},{""imageOffset"":1149699,""symbol"":""_PyEval_EvalCode"",""symbolLocation"":2611,""imageIndex"":1},{""imageOffset"":1109419,""symbol"":""PyEval_EvalCode"",""symbolLocation"":139,""imageIndex"":1},{""imageOffset"":1096722,""symbol"":""builtin_exec"",""symbolLocation"":626,""imageIndex"":1},{""imageOffset"":516131,""symbol"":""cfunction_vectorcall_FASTCALL"",""symbolLocation"":195,""imageIndex"":1},{""imageOffset"":1146380,""symbol"":""call_function"",""symbolLocation"":732,""imageIndex"":1},{""imageOffset"":1135435,""symbol"":""_PyEval_EvalFrameDefault"",""symbolLocation"":25723,""imageIndex"":1},{""imageOffset"":1149699,""symbol"":""_PyEval_EvalCode"",""symbolLocation"":2611,""imageIndex"":1},{""imageOffset"":261297,""symbol"":""_PyFunction_Vectorcall"",""symbolLocation"":289,""imageIndex"":1},{""imageOffset"":1146380,""symbol"":""call_function"",""symbolLocation"":732,""imageIndex"":1},{""imageOffset"":1135435,""symbol"":""_PyEval_EvalFrameDefault"",""symbolLocation"":25723,""imageIndex"":1},{""imageOffset"":1149699,""symbol"":""_PyEval_EvalCode"",""symbolLocation"":2611,""imageIndex"":1},{""imageOffset"":261297,""symbol"":""_PyFunction_Vectorcall"",""symbolLocation"":289,""imageIndex"":1},{""imageOffset"":1566832,""symbol"":""pymain_run_module"",""symbolLocation"":208,""imageIndex"":1},{""imageOffset"":1564551,""symbol"":""Py_RunMain"",""symbolLocation"":1431,""imageIndex"":1},{""imageOffset"":1566095,""symbol"":""pymain_main"",""symbolLocation"":223,""imageIndex"":1},{""imageOffset"":1565851,""symbol"":""Py_Main"",""symbolLocation"":43,""imageIndex"":1},{""imageOffset"":3528,""symbol"":""main"",""symbolLocation"":120,""imageIndex"":0},{""imageOffset"":25631,""symbol"":""start"",""symbolLocation"":1903,""imageIndex"":161}],""id"":2685069,""triggered"":true,""threadState"":{""r13"":{""value"":140378515198288},""rax"":{""value"":0},""rflags"":{""value"":582},""cpu"":{""value"":0},""r14"":{""value"":11},""rsi"":{""value"":11},""r8"":{""value"":140378371350344},""cr2"":{""value"":140378364817272},""rdx"":{""value"":0},""r10"":{""value"":140704640258880,""symbolLocation"":0,""symbol"":""_main_thread""},""r9"":{""value"":13566497374258238407},""r15"":{""value"":22},""rbx"":{""value"":140704640258880,""symbolLocation"":0,""symbol"":""_main_thread""},""trap"":{""value"":133},""err"":{""value"":33554760},""r11"":{""value"":582},""rip"":{""value"":140703508799986,""matchesCrashFrame"":1},""rbp"":{""value"":140378371349120},""rsp"":{""value"":140378371349080},""r12"":{""value"":259},""rcx"":{""value"":140378371349080},""flavor"":""x86_THREAD_STATE"",""rdi"":{""value"":259}},""name"":""CrBrowserMain""},{""id"":2685150,""name"":""ThreadPoolServiceThread"",""frames"":[{""imageOffset"":44566,""symbol"":""kevent64"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":72176586,""imageIndex"":55},{""imageOffset"":72176239,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71838381,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685153,""name"":""Chrome_IOThread"",""frames"":[{""imageOffset"":44566,""symbol"":""kevent64"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":72176586,""imageIndex"":55},{""imageOffset"":72176239,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":30119282,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685154,""name"":""NetworkConfigWatcher"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":72148767,""imageIndex"":55},{""imageOffset"":71278185,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685158,""name"":""Chrome_InProcGpuThread"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":72148767,""imageIndex"":55},{""imageOffset"":71278185,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685159,""name"":""Chrome_ChildIOThread"",""frames"":[{""imageOffset"":44566,""symbol"":""kevent64"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":72176586,""imageIndex"":55},{""imageOffset"":72176239,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":118470786,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685160,""name"":""CompositorTileWorker1"",""frames"":[{""imageOffset"":16622,""symbol"":""__psynch_cvwait"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":26456,""symbol"":""_pthread_cond_wait"",""symbolLocation"":1242,""imageIndex"":152},{""imageOffset"":72117794,""imageIndex"":55},{""imageOffset"":108041477,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685161,""name"":""ThreadPoolSingleThreadSharedForeground0"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":71890095,""imageIndex"":55},{""imageOffset"":71893079,""imageIndex"":55},{""imageOffset"":71891901,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685162,""name"":""NetworkConfigWatcher"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":72148767,""imageIndex"":55},{""imageOffset"":71278185,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685163,""name"":""VizCompositorThread"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":71278088,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685165,""name"":""NetworkService"",""frames"":[{""imageOffset"":44566,""symbol"":""kevent64"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":72176586,""imageIndex"":55},{""imageOffset"":72176239,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685166,""name"":""NetworkConfigWatcher"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":72148767,""imageIndex"":55},{""imageOffset"":71278185,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685167,""name"":""ThreadPoolSingleThreadForegroundBlocking1"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":71890095,""imageIndex"":55},{""imageOffset"":71893079,""imageIndex"":55},{""imageOffset"":71891949,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685195,""name"":""NetworkConfigWatcher"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":72148767,""imageIndex"":55},{""imageOffset"":71278185,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685220,""frames"":[{""imageOffset"":16622,""symbol"":""__psynch_cvwait"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":26456,""symbol"":""_pthread_cond_wait"",""symbolLocation"":1242,""imageIndex"":152},{""imageOffset"":3445311,""symbol"":""blas_thread_server"",""symbolLocation"":207,""imageIndex"":17},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685221,""frames"":[{""imageOffset"":16622,""symbol"":""__psynch_cvwait"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":26456,""symbol"":""_pthread_cond_wait"",""symbolLocation"":1242,""imageIndex"":152},{""imageOffset"":3445311,""symbol"":""blas_thread_server"",""symbolLocation"":207,""imageIndex"":17},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685222,""frames"":[{""imageOffset"":16622,""symbol"":""__psynch_cvwait"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":26456,""symbol"":""_pthread_cond_wait"",""symbolLocation"":1242,""imageIndex"":152},{""imageOffset"":3445311,""symbol"":""blas_thread_server"",""symbolLocation"":207,""imageIndex"":17},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685249,""name"":""com.apple.NSEventThread"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":38828,""symbol"":""CGSSnarfAndDispatchDatagrams"",""symbolLocation"":160,""imageIndex"":156},{""imageOffset"":3288317,""symbol"":""SLSGetNextEventRecordInternal"",""symbolLocation"":284,""imageIndex"":156},{""imageOffset"":1319776,""symbol"":""SLEventCreateNextEvent"",""symbolLocation"":9,""imageIndex"":156},{""imageOffset"":237769,""symbol"":""PullEventsFromWindowServerOnConnection(unsigned int, unsigned char, __CFMachPortBoost*)"",""symbolLocation"":268,""imageIndex"":159},{""imageOffset"":237451,""symbol"":""MessageHandler(__CFMachPort*, void*, long, void*)"",""symbolLocation"":48,""imageIndex"":159},{""imageOffset"":700006,""symbol"":""__CFMachPortPerform"",""symbolLocation"":244,""imageIndex"":158},{""imageOffset"":513443,""symbol"":""__CFRUNLOOP_IS_CALLING_OUT_TO_A_SOURCE1_PERFORM_FUNCTION__"",""symbolLocation"":41,""imageIndex"":158},{""imageOffset"":513251,""symbol"":""__CFRunLoopDoSource1"",""symbolLocation"":540,""imageIndex"":158},{""imageOffset"":508257,""symbol"":""__CFRunLoopRun"",""symbolLocation"":2694,""imageIndex"":158},{""imageOffset"":503921,""symbol"":""CFRunLoopRunSpecific"",""symbolLocation"":560,""imageIndex"":158},{""imageOffset"":1698057,""symbol"":""_NSEventThread"",""symbolLocation"":132,""imageIndex"":160},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685293,""name"":""MemoryInfra"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":72148767,""imageIndex"":55},{""imageOffset"":71278185,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2685294,""name"":""ThreadPoolSingleThreadSharedBackgroundBlocking2"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":71890095,""imageIndex"":55},{""imageOffset"":71892236,""imageIndex"":55},{""imageOffset"":71891757,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":2696004,""name"":""NetworkConfigWatcher"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":72148767,""imageIndex"":55},{""imageOffset"":71278185,""imageIndex"":55},{""imageOffset"":71786483,""imageIndex"":55},{""imageOffset"":71490098,""imageIndex"":55},{""imageOffset"":71944792,""imageIndex"":55},{""imageOffset"":71945194,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3082467,""name"":""ThreadPoolForegroundWorker"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":71890095,""imageIndex"":55},{""imageOffset"":71893079,""imageIndex"":55},{""imageOffset"":71891853,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3084913,""name"":""ThreadPoolBackgroundWorker"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":71890095,""imageIndex"":55},{""imageOffset"":71893079,""imageIndex"":55},{""imageOffset"":71891709,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3129579,""name"":""QFileInfoGatherer"",""frames"":[{""imageOffset"":16622,""symbol"":""__psynch_cvwait"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":26456,""symbol"":""_pthread_cond_wait"",""symbolLocation"":1242,""imageIndex"":152},{""imageOffset"":2108299,""imageIndex"":45},{""imageOffset"":2108158,""symbol"":""QWaitCondition::wait(QMutex*, QDeadlineTimer)"",""symbolLocation"":94,""imageIndex"":45},{""imageOffset"":4640285,""symbol"":""QFileInfoGatherer::run()"",""symbolLocation"":125,""imageIndex"":49},{""imageOffset"":2067843,""imageIndex"":45},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3222111,""frames"":[{""imageOffset"":7088,""symbol"":""start_wqthread"",""symbolLocation"":0,""imageIndex"":152}]},{""id"":3226254,""queue"":""com.apple.CFMachPort"",""frames"":[{""imageOffset"":281652,""symbol"":""CFSetGetValue"",""symbolLocation"":33,""imageIndex"":158},{""imageOffset"":650875,""symbol"":""_cfmp_source_invalidated"",""symbolLocation"":89,""imageIndex"":158},{""imageOffset"":650771,""symbol"":""___CFMachPortCreateWithPort2_block_invoke"",""symbolLocation"":19,""imageIndex"":158},{""imageOffset"":7569,""symbol"":""_dispatch_call_block_and_release"",""symbolLocation"":12,""imageIndex"":157},{""imageOffset"":12339,""symbol"":""_dispatch_client_callout"",""symbolLocation"":8,""imageIndex"":157},{""imageOffset"":23397,""symbol"":""_dispatch_continuation_pop"",""symbolLocation"":463,""imageIndex"":157},{""imageOffset"":98497,""symbol"":""_dispatch_source_cancel_callout"",""symbolLocation"":153,""imageIndex"":157},{""imageOffset"":95270,""symbol"":""_dispatch_source_invoke"",""symbolLocation"":1279,""imageIndex"":157},{""imageOffset"":37000,""symbol"":""_dispatch_lane_serial_drain"",""symbolLocation"":393,""imageIndex"":157},{""imageOffset"":40249,""symbol"":""_dispatch_lane_invoke"",""symbolLocation"":366,""imageIndex"":157},{""imageOffset"":82940,""symbol"":""_dispatch_workloop_worker_thread"",""symbolLocation"":765,""imageIndex"":157},{""imageOffset"":11349,""symbol"":""_pthread_wqthread"",""symbolLocation"":327,""imageIndex"":152},{""imageOffset"":7103,""symbol"":""start_wqthread"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3226478,""name"":""ThreadPoolForegroundWorker"",""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":34276,""symbol"":""mach_msg_overwrite"",""symbolLocation"":692,""imageIndex"":151},{""imageOffset"":6298,""symbol"":""mach_msg"",""symbolLocation"":19,""imageIndex"":151},{""imageOffset"":72149299,""imageIndex"":55},{""imageOffset"":71890095,""imageIndex"":55},{""imageOffset"":71893079,""imageIndex"":55},{""imageOffset"":71891853,""imageIndex"":55},{""imageOffset"":72123480,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3226915,""frames"":[{""imageOffset"":7088,""symbol"":""start_wqthread"",""symbolLocation"":0,""imageIndex"":152}]},{""id"":3226917,""frames"":[{""imageOffset"":5554,""symbol"":""mach_msg2_trap"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":63277,""symbol"":""mach_msg2_internal"",""symbolLocation"":78,""imageIndex"":151},{""imageOffset"":25694,""symbol"":""_kernelrpc_thread_policy_set"",""symbolLocation"":172,""imageIndex"":151},{""imageOffset"":25472,""symbol"":""thread_policy_set"",""symbolLocation"":15,""imageIndex"":151},{""imageOffset"":6136548,""symbol"":""-[NSThread _setThreadPriority:]"",""symbolLocation"":299,""imageIndex"":162},{""imageOffset"":72387245,""imageIndex"":55},{""imageOffset"":72123416,""imageIndex"":55},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3226957,""name"":""Thread (pooled)"",""frames"":[{""imageOffset"":16622,""symbol"":""__psynch_cvwait"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":26456,""symbol"":""_pthread_cond_wait"",""symbolLocation"":1242,""imageIndex"":152},{""imageOffset"":2109100,""imageIndex"":45},{""imageOffset"":2108334,""imageIndex"":45},{""imageOffset"":2108158,""symbol"":""QWaitCondition::wait(QMutex*, QDeadlineTimer)"",""symbolLocation"":94,""imageIndex"":45},{""imageOffset"":2085349,""imageIndex"":45},{""imageOffset"":2067843,""imageIndex"":45},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3226958,""name"":""Thread (pooled)"",""frames"":[{""imageOffset"":16622,""symbol"":""__psynch_cvwait"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":26456,""symbol"":""_pthread_cond_wait"",""symbolLocation"":1242,""imageIndex"":152},{""imageOffset"":2109100,""imageIndex"":45},{""imageOffset"":2108334,""imageIndex"":45},{""imageOffset"":2108158,""symbol"":""QWaitCondition::wait(QMutex*, QDeadlineTimer)"",""symbolLocation"":94,""imageIndex"":45},{""imageOffset"":2085349,""imageIndex"":45},{""imageOffset"":2067843,""imageIndex"":45},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3226959,""name"":""Thread (pooled)"",""frames"":[{""imageOffset"":16622,""symbol"":""__psynch_cvwait"",""symbolLocation"":10,""imageIndex"":151},{""imageOffset"":26456,""symbol"":""_pthread_cond_wait"",""symbolLocation"":1242,""imageIndex"":152},{""imageOffset"":2109100,""imageIndex"":45},{""imageOffset"":2108334,""imageIndex"":45},{""imageOffset"":2108158,""symbol"":""QWaitCondition::wait(QMutex*, QDeadlineTimer)"",""symbolLocation"":94,""imageIndex"":45},{""imageOffset"":2085349,""imageIndex"":45},{""imageOffset"":2067843,""imageIndex"":45},{""imageOffset"":25043,""symbol"":""_pthread_start"",""symbolLocation"":125,""imageIndex"":152},{""imageOffset"":7123,""symbol"":""thread_start"",""symbolLocation"":15,""imageIndex"":152}]},{""id"":3226989,""frames"":[{""imageOffset"":7088,""symbol"":""start_wqthread"",""symbolLocation"":0,""imageIndex"":152}]}], ""usedImages"" : [ { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4412698624, ""CFBundleShortVersionString"" : ""1.6.1"", ""CFBundleIdentifier"" : ""edu.ucsf.cgl.ChimeraX"", ""size"" : 4096, ""uuid"" : ""5df621ee-554e-36a8-b448-93b2334e5480"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/MacOS\/ChimeraX"", ""name"" : ""ChimeraX"", ""CFBundleVersion"" : ""1.6.1.0"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4420542464, ""CFBundleShortVersionString"" : ""3.9.11, (c) 2001-2021 Python Software Foundation."", ""CFBundleIdentifier"" : ""org.python.python"", ""size"" : 2527232, ""uuid"" : ""ef9cc1f4-5991-3213-9a9e-e68c578b6c1b"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/Python"", ""name"" : ""Python"", ""CFBundleVersion"" : ""3.9.11"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413292544, ""size"" : 12288, ""uuid"" : ""26e2211d-6e3c-34a0-9ef2-e395ec9e55ec"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_heapq.cpython-39-darwin.so"", ""name"" : ""_heapq.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413153280, ""size"" : 20480, ""uuid"" : ""0d397cb0-ba52-314e-bd56-863340384c78"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/binascii.cpython-39-darwin.so"", ""name"" : ""binascii.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413210624, ""size"" : 24576, ""uuid"" : ""b9299f10-06ed-376d-94f7-5f40a9a019ce"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/zlib.cpython-39-darwin.so"", ""name"" : ""zlib.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413485056, ""size"" : 12288, ""uuid"" : ""acea136f-27d9-3006-b785-f415ed7c491c"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_bz2.cpython-39-darwin.so"", ""name"" : ""_bz2.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4414091264, ""size"" : 204800, ""uuid"" : ""d7e1b7aa-2530-3908-b749-1ddf8aad37bb"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_lzma.cpython-39-darwin.so"", ""name"" : ""_lzma.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413534208, ""size"" : 8192, ""uuid"" : ""eba0bbb2-1ee4-33c8-b2c3-e0ca34b5efb2"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/grp.cpython-39-darwin.so"", ""name"" : ""grp.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413341696, ""size"" : 24576, ""uuid"" : ""5f0c5830-adfd-3807-a69b-3ac334660886"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_struct.cpython-39-darwin.so"", ""name"" : ""_struct.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413800448, ""size"" : 36864, ""uuid"" : ""87ed7f18-fdc5-3cc8-97f0-ee393ee6ab9f"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/math.cpython-39-darwin.so"", ""name"" : ""math.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413423616, ""size"" : 8192, ""uuid"" : ""9e551319-6228-323e-961d-0102241059ad"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_bisect.cpython-39-darwin.so"", ""name"" : ""_bisect.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413722624, ""size"" : 8192, ""uuid"" : ""d7ea60e7-dc7b-30c1-968b-07c80dec058e"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_random.cpython-39-darwin.so"", ""name"" : ""_random.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413579264, ""size"" : 20480, ""uuid"" : ""dcac7b53-ad00-326b-86a5-ab8ee3c866b3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_sha512.cpython-39-darwin.so"", ""name"" : ""_sha512.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413636608, ""size"" : 4096, ""uuid"" : ""260d58a8-ac64-3d93-ad4e-8e24c7ed2c7a"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/arrays\/_arrays.cpython-39-darwin.so"", ""name"" : ""_arrays.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4415827968, ""size"" : 663552, ""uuid"" : ""7e891c56-f468-3ac7-926a-b3efe3e69557"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/arrays\/lib\/libarrays.dylib"", ""name"" : ""libarrays.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4414365696, ""size"" : 24576, ""uuid"" : ""548d7da5-6a01-3908-b0e7-cf52811a65eb"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_json.cpython-39-darwin.so"", ""name"" : ""_json.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4434018304, ""size"" : 4489216, ""uuid"" : ""3c57f0c7-97af-382e-bdaf-5b192a395a0c"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/core\/_multiarray_umath.cpython-39-darwin.so"", ""name"" : ""_multiarray_umath.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4529451008, ""size"" : 64028672, ""uuid"" : ""24c9d5c5-4854-3af4-9550-cb0204044dfa"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libopenblas64_.0.dylib"", ""name"" : ""libopenblas64_.0.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4418236416, ""size"" : 1146880, ""uuid"" : ""9abe5ede-ad43-391a-9e54-866711fac32a"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libgfortran.3.dylib"", ""name"" : ""libgfortran.3.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4414730240, ""size"" : 225280, ""uuid"" : ""7ffa409f-fb04-3b64-be9a-3e3a494c975e"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libquadmath.0.dylib"", ""name"" : ""libquadmath.0.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413890560, ""size"" : 90112, ""uuid"" : ""7c6d7cb7-82db-3290-8181-07646fea1f80"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/.dylibs\/libgcc_s.1.dylib"", ""name"" : ""libgcc_s.1.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4414427136, ""size"" : 65536, ""uuid"" : ""b167e339-2809-37ba-8e75-5887037a5a03"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_datetime.cpython-39-darwin.so"", ""name"" : ""_datetime.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4415401984, ""size"" : 98304, ""uuid"" : ""a0f1736c-019e-304a-831b-33c61292773f"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_pickle.cpython-39-darwin.so"", ""name"" : ""_pickle.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4415041536, ""size"" : 81920, ""uuid"" : ""19fff319-9db7-3f06-86fd-431cf039cbdd"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/core\/_multiarray_tests.cpython-39-darwin.so"", ""name"" : ""_multiarray_tests.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4415238144, ""size"" : 12288, ""uuid"" : ""14c199de-bb55-3957-b5e3-5186e436f6f7"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_posixsubprocess.cpython-39-darwin.so"", ""name"" : ""_posixsubprocess.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4414570496, ""size"" : 20480, ""uuid"" : ""2f042ce6-bef0-3ad9-97f5-2da7655122a4"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/select.cpython-39-darwin.so"", ""name"" : ""select.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4415574016, ""size"" : 73728, ""uuid"" : ""865f1d2b-bb7c-3188-a588-737beec80b87"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_ctypes.cpython-39-darwin.so"", ""name"" : ""_ctypes.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4417101824, ""size"" : 114688, ""uuid"" : ""e0295914-340c-31b8-90e3-ab43913e9c42"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/linalg\/_umath_linalg.cpython-39-darwin.so"", ""name"" : ""_umath_linalg.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4416917504, ""size"" : 81920, ""uuid"" : ""8f950734-eaf8-30d8-90fa-19315f9e3cb1"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/fft\/_pocketfft_internal.cpython-39-darwin.so"", ""name"" : ""_pocketfft_internal.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4417331200, ""size"" : 475136, ""uuid"" : ""78637382-a5da-3b41-80af-140e50bd93f3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/mtrand.cpython-39-darwin.so"", ""name"" : ""mtrand.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4424429568, ""size"" : 131072, ""uuid"" : ""2bbe12ec-f3f9-3d48-8d9d-5d78fe52a418"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/bit_generator.cpython-39-darwin.so"", ""name"" : ""bit_generator.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4424708096, ""size"" : 229376, ""uuid"" : ""f8b8d031-7753-33cd-93f8-b9ee523054ab"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_common.cpython-39-darwin.so"", ""name"" : ""_common.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4414627840, ""size"" : 28672, ""uuid"" : ""388ef3f8-6fc4-3be1-8cec-68f80b144aa3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_hashlib.cpython-39-darwin.so"", ""name"" : ""_hashlib.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4419833856, ""size"" : 368640, ""uuid"" : ""9b470578-8ffb-3e67-9fe0-7446a9ba507b"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/libssl.1.1.dylib"", ""name"" : ""libssl.1.1.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4430221312, ""size"" : 2195456, ""uuid"" : ""73600d5b-8efd-3996-af09-e02c28d67dcb"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/libcrypto.1.1.dylib"", ""name"" : ""libcrypto.1.1.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4415287296, ""size"" : 28672, ""uuid"" : ""673b41f3-28be-3326-bbd9-f33c09b2c664"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_blake2.cpython-39-darwin.so"", ""name"" : ""_blake2.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4426051584, ""size"" : 344064, ""uuid"" : ""c031b4b0-9fe6-3f12-b72d-61b1b63fa4f2"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_bounded_integers.cpython-39-darwin.so"", ""name"" : ""_bounded_integers.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4416643072, ""size"" : 65536, ""uuid"" : ""28eb0207-3278-3299-a6e1-af6198c95536"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_mt19937.cpython-39-darwin.so"", ""name"" : ""_mt19937.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4425355264, ""size"" : 65536, ""uuid"" : ""dbeca4b1-3fb3-3a81-a2fe-4ff45340f900"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_philox.cpython-39-darwin.so"", ""name"" : ""_philox.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4425068544, ""size"" : 65536, ""uuid"" : ""d29931bb-5833-38e0-b60c-ec87f9495fa4"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_pcg64.cpython-39-darwin.so"", ""name"" : ""_pcg64.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4416790528, ""size"" : 32768, ""uuid"" : ""e84a3da1-4290-32da-98dc-8d8e708fca1a"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_sfc64.cpython-39-darwin.so"", ""name"" : ""_sfc64.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4428537856, ""size"" : 589824, ""uuid"" : ""793608fd-338f-3f47-abff-e2dc17331adb"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/random\/_generator.cpython-39-darwin.so"", ""name"" : ""_generator.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4413677568, ""size"" : 4096, ""uuid"" : ""d0f47093-7e88-3d31-9906-b6b48a0ff811"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_opcode.cpython-39-darwin.so"", ""name"" : ""_opcode.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4426592256, ""size"" : 126976, ""uuid"" : ""75eff895-415d-3be0-9017-952a6d6c54c5"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/geometry\/_geometry.cpython-39-darwin.so"", ""name"" : ""_geometry.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4514193408, ""size"" : 1605632, ""uuid"" : ""5590e5eb-1a53-3bf0-9ffc-71d23992c730"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtCore.abi3.so"", ""name"" : ""QtCore.abi3.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4507025408, ""size"" : 5210112, ""uuid"" : ""6238782e-d1aa-3245-81ef-2925bf1a4c96"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtCore.framework\/Versions\/A\/QtCore"", ""name"" : ""QtCore"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4425764864, ""size"" : 98304, ""uuid"" : ""f511de72-2757-3ff5-8524-716ba83b7953"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/sip.cpython-39-darwin.so"", ""name"" : ""sip.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4517732352, ""size"" : 2834432, ""uuid"" : ""951581e2-ae51-392a-82d9-fdf83e162d11"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWidgets.abi3.so"", ""name"" : ""QtWidgets.abi3.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4706263040, ""size"" : 4931584, ""uuid"" : ""5bfaef33-ce47-32bf-acb3-03cbe9e68a6f"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWidgets.framework\/Versions\/A\/QtWidgets"", ""name"" : ""QtWidgets"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4693905408, ""size"" : 7094272, ""uuid"" : ""cf0b9ade-9377-380e-9a84-904983d7bb60"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtGui.framework\/Versions\/A\/QtGui"", ""name"" : ""QtGui"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4433068032, ""size"" : 540672, ""uuid"" : ""d75bc176-b599-346d-9c20-e26d546cecdf"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtDBus.framework\/Versions\/A\/QtDBus"", ""name"" : ""QtDBus"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4523892736, ""size"" : 1490944, ""uuid"" : ""9c3eb0df-69a3-3b03-ab77-80606e4891d2"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtGui.abi3.so"", ""name"" : ""QtGui.abi3.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4427132928, ""size"" : 65536, ""uuid"" : ""8d885ad7-b0a5-3652-95d8-53791eacb3ca"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWebEngineWidgets.abi3.so"", ""name"" : ""QtWebEngineWidgets.abi3.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4426809344, ""size"" : 81920, ""uuid"" : ""1e9cc466-23ad-39e2-80a4-31ff007d87d5"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWebEngineWidgets.framework\/Versions\/A\/QtWebEngineWidgets"", ""name"" : ""QtWebEngineWidgets"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4429586432, ""size"" : 294912, ""uuid"" : ""7178d391-3db2-3825-b031-83a02c9069fa"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtPrintSupport.framework\/Versions\/A\/QtPrintSupport"", ""name"" : ""QtPrintSupport"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 5062676480, ""size"" : 174571520, ""uuid"" : ""473ca65c-6149-3bfa-a88b-95ac735bcd3b"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWebEngineCore.framework\/Versions\/A\/QtWebEngineCore"", ""name"" : ""QtWebEngineCore"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4723576832, ""size"" : 4194304, ""uuid"" : ""2320a4ff-4480-3fab-b65e-d0bfa30e7175"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQuick.framework\/Versions\/A\/QtQuick"", ""name"" : ""QtQuick"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4513038336, ""size"" : 425984, ""uuid"" : ""801f31da-cbeb-31ff-b9cf-f6db264a808b"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtOpenGL.framework\/Versions\/A\/QtOpenGL"", ""name"" : ""QtOpenGL"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4427280384, ""size"" : 540672, ""uuid"" : ""9b2c88ec-5704-30b2-ad3d-1029261e37b3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQmlModels.framework\/Versions\/A\/QtQmlModels"", ""name"" : ""QtQmlModels"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4428001280, ""size"" : 196608, ""uuid"" : ""7680348f-ddbb-3d03-b57e-51a794fc69aa"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtWebChannel.framework\/Versions\/A\/QtWebChannel"", ""name"" : ""QtWebChannel"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4729262080, ""size"" : 4112384, ""uuid"" : ""b142d2df-822a-3c32-93f9-9c3a3c116594"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQml.framework\/Versions\/A\/QtQml"", ""name"" : ""QtQml"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4527169536, ""size"" : 1163264, ""uuid"" : ""4e8fb178-39bd-37fc-92f2-6fbc9d82af88"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtNetwork.framework\/Versions\/A\/QtNetwork"", ""name"" : ""QtNetwork"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4528676864, ""size"" : 491520, ""uuid"" : ""bc6797b4-2790-31eb-91cb-ec099d47f563"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtPositioning.framework\/Versions\/A\/QtPositioning"", ""name"" : ""QtPositioning"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4428296192, ""size"" : 81920, ""uuid"" : ""e7d49a3d-a512-3f57-8fe3-a90e0c97f2c2"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtQuickWidgets.framework\/Versions\/A\/QtQuickWidgets"", ""name"" : ""QtQuickWidgets"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4420403200, ""size"" : 32768, ""uuid"" : ""da4429b4-302e-3d2b-9b06-391152bff6fa"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWebChannel.abi3.so"", ""name"" : ""QtWebChannel.abi3.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4704497664, ""size"" : 458752, ""uuid"" : ""7dd9c25c-c2a0-3248-8f79-da774e47248d"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtNetwork.abi3.so"", ""name"" : ""QtNetwork.abi3.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4703473664, ""size"" : 212992, ""uuid"" : ""bbba7cd3-3207-3cce-b34b-1c5d98ea53eb"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtWebEngineCore.abi3.so"", ""name"" : ""QtWebEngineCore.abi3.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4513660928, ""size"" : 147456, ""uuid"" : ""8dd82bcd-6f94-324d-b419-e93c71b99376"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/QtPrintSupport.abi3.so"", ""name"" : ""QtPrintSupport.abi3.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4714430464, ""size"" : 638976, ""uuid"" : ""7175bc4c-ca2f-30b6-9734-062b84bd0ae2"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/platforms\/libqcocoa.dylib"", ""name"" : ""libqcocoa.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4703010816, ""size"" : 163840, ""uuid"" : ""60501060-de6d-35b6-8325-74cf1323cca0"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/styles\/libqmacstyle.dylib"", ""name"" : ""libqmacstyle.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4529315840, ""size"" : 12288, ""uuid"" : ""887805e6-e59a-3c6e-b025-b018d0d5e48b"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/fcntl.cpython-39-darwin.so"", ""name"" : ""fcntl.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4704063488, ""size"" : 180224, ""uuid"" : ""620756c7-4f13-3305-b7e6-2653d410e4a6"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/pyexpat.cpython-39-darwin.so"", ""name"" : ""pyexpat.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4703272960, ""size"" : 57344, ""uuid"" : ""4be1a98e-c179-38fa-854c-0dc2cc23696d"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_socket.cpython-39-darwin.so"", ""name"" : ""_socket.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4529364992, ""size"" : 32768, ""uuid"" : ""7d6b64db-191d-3216-97d9-ac978b08929e"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/array.cpython-39-darwin.so"", ""name"" : ""array.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4703383552, ""size"" : 8192, ""uuid"" : ""1eae6074-8612-3bc6-b16b-c173a995e90c"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_queue.cpython-39-darwin.so"", ""name"" : ""_queue.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4704342016, ""size"" : 20480, ""uuid"" : ""73712781-c20d-3f97-9760-5c95eb030227"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_csv.cpython-39-darwin.so"", ""name"" : ""_csv.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4514152448, ""size"" : 4096, ""uuid"" : ""bf662773-0d04-3254-b643-bbe11593cfbd"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/_load_libs.cpython-39-darwin.so"", ""name"" : ""_load_libs.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4773732352, ""size"" : 1253376, ""uuid"" : ""5192d8ff-91ee-3ba1-acbe-0cc0875d9dd3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/lib\/libatomstruct.dylib"", ""name"" : ""libatomstruct.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4704399360, ""size"" : 24576, ""uuid"" : ""40ef14e9-a17d-39b6-be0c-127555677085"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/lib\/libelement.dylib"", ""name"" : ""libelement.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4703428608, ""size"" : 4096, ""uuid"" : ""6f0774d3-c270-3d3b-a12f-e63ec563d40d"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic_lib\/lib\/libpyinstance.dylib"", ""name"" : ""libpyinstance.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4705619968, ""size"" : 217088, ""uuid"" : ""7e9191e6-b126-301c-9f6a-d5b23f0013b8"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/libmolc.dylib"", ""name"" : ""libmolc.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4754276352, ""size"" : 372736, ""uuid"" : ""95fc95cc-2a76-36f6-b171-503f2c5e75cb"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/cymol.cpython-39-darwin.so"", ""name"" : ""cymol.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4770529280, ""size"" : 110592, ""uuid"" : ""3b4799e1-0245-3f6e-9109-a9ac8206aefd"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/tinyarray.cpython-39-darwin.so"", ""name"" : ""tinyarray.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4706107392, ""size"" : 36864, ""uuid"" : ""6ea8e4d1-a62b-3827-9897-2823a0b67614"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/cytmpl.cpython-39-darwin.so"", ""name"" : ""cytmpl.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4772114432, ""size"" : 548864, ""uuid"" : ""9dcd38a4-f108-3a57-9c0e-954d70f6b885"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/map\/_map.cpython-39-darwin.so"", ""name"" : ""_map.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4770766848, ""size"" : 86016, ""uuid"" : ""b9c1eb65-29b3-3cc9-87cb-63be7734a3c7"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_ssl.cpython-39-darwin.so"", ""name"" : ""_ssl.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4706217984, ""size"" : 4096, ""uuid"" : ""f905c35e-44ce-3ab4-b790-b5efa6fa95e8"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_scproxy.cpython-39-darwin.so"", ""name"" : ""_scproxy.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4723445760, ""size"" : 16384, ""uuid"" : ""e41a65c4-df75-3d5a-890b-9a8577668c95"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/charset_normalizer\/md.cpython-39-darwin.so"", ""name"" : ""md.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4770050048, ""size"" : 131072, ""uuid"" : ""3fdee7fa-47ca-3a24-bdf1-a967c1e82890"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/charset_normalizer\/md__mypyc.cpython-39-darwin.so"", ""name"" : ""md__mypyc.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4777984000, ""size"" : 1093632, ""uuid"" : ""d95f3165-cb18-3268-914d-e0787602c93f"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/unicodedata.cpython-39-darwin.so"", ""name"" : ""unicodedata.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4754915328, ""size"" : 20480, ""uuid"" : ""b6eb0e34-67c7-373c-8f57-ea91e98a9b10"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_multibytecodec.cpython-39-darwin.so"", ""name"" : ""_multibytecodec.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4723511296, ""size"" : 4096, ""uuid"" : ""f5a33081-e839-36e3-aac1-06c51c431620"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_uuid.cpython-39-darwin.so"", ""name"" : ""_uuid.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4772859904, ""size"" : 307200, ""uuid"" : ""859b4edd-8da4-3f22-86e0-07538c7b5aa5"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_decimal.cpython-39-darwin.so"", ""name"" : ""_decimal.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4770967552, ""size"" : 819200, ""uuid"" : ""ec819ef5-b16f-3f6b-b23d-03751398c0a3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/_imaging.cpython-39-darwin.so"", ""name"" : ""_imaging.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4776923136, ""size"" : 557056, ""uuid"" : ""91766682-e5af-36de-8e46-40aae99e8ebc"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libopenjp2.2.5.0.dylib"", ""name"" : ""libopenjp2.2.5.0.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4770344960, ""size"" : 131072, ""uuid"" : ""b683b844-94c8-3f8a-beb5-91a6d8400c27"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libz.1.2.13.dylib"", ""name"" : ""libz.1.2.13.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4775645184, ""size"" : 1081344, ""uuid"" : ""89eeb1e7-5ff6-38db-8cb6-e21e09420bfe"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libtiff.5.dylib"", ""name"" : ""libtiff.5.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4773294080, ""size"" : 163840, ""uuid"" : ""15c6e7fa-c3e7-3ee3-ae79-9a665bbdde8d"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libxcb.1.1.0.dylib"", ""name"" : ""libxcb.1.1.0.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4777562112, ""size"" : 196608, ""uuid"" : ""b0d3eea1-3ea6-3ee2-bf57-abab390b6e3c"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/liblzma.5.dylib"", ""name"" : ""liblzma.5.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4772016128, ""size"" : 16384, ""uuid"" : ""568add8e-f7cf-38b0-9331-09a426332386"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libXau.6.dylib"", ""name"" : ""libXau.6.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4773646336, ""size"" : 16384, ""uuid"" : ""c019ad02-bd14-398d-a4fd-e9e4afb4b6e0"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PIL\/.dylibs\/libXdmcp.6.dylib"", ""name"" : ""libXdmcp.6.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4773572608, ""size"" : 12288, ""uuid"" : ""16da837b-0859-30b7-ba52-b0f481c0e785"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/termios.cpython-39-darwin.so"", ""name"" : ""termios.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4779134976, ""size"" : 16384, ""uuid"" : ""ade40abc-2f4a-329a-85cd-79f89e46722e"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/_c_internal_utils.cpython-39-darwin.so"", ""name"" : ""_c_internal_utils.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4779610112, ""size"" : 131072, ""uuid"" : ""15c5112f-e802-397a-ab70-78b767c00ddf"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/_path.cpython-39-darwin.so"", ""name"" : ""_path.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4781518848, ""size"" : 671744, ""uuid"" : ""e6de4cc7-aef8-3516-9028-7d24011f9a4a"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/ft2font.cpython-39-darwin.so"", ""name"" : ""ft2font.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4779200512, ""size"" : 98304, ""uuid"" : ""8a1f8383-59fa-3629-9c87-465192203088"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/kiwisolver\/_cext.cpython-39-darwin.so"", ""name"" : ""_cext.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4780236800, ""size"" : 163840, ""uuid"" : ""95976df9-a305-3674-b12c-d53106a0a7fb"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/matplotlib\/_image.cpython-39-darwin.so"", ""name"" : ""_image.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4779806720, ""size"" : 151552, ""uuid"" : ""9a40449f-d479-3ae9-a9d8-3f7a8d89b1ba"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/surface\/_surface.cpython-39-darwin.so"", ""name"" : ""_surface.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4776873984, ""size"" : 4096, ""uuid"" : ""eb6596f0-6c8e-33b8-a8e2-f6609e0a6d86"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/pdb_lib\/_load_libs.cpython-39-darwin.so"", ""name"" : ""_load_libs.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4777824256, ""size"" : 24576, ""uuid"" : ""f9157b35-e0ad-39d9-a2be-d1613dfc0ba2"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/pdb_lib\/lib\/libpdbconnect.dylib"", ""name"" : ""libpdbconnect.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4779446272, ""size"" : 36864, ""uuid"" : ""4d4d6c45-fa58-3cee-b1fd-935c81b3d0b4"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/errorchecker.cpython-39-darwin.so"", ""name"" : ""errorchecker.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4781109248, ""size"" : 176128, ""uuid"" : ""92179bb5-b1e9-3d74-ab97-1ebb7d7ae1e3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/arraydatatype.cpython-39-darwin.so"", ""name"" : ""arraydatatype.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4780466176, ""size"" : 208896, ""uuid"" : ""02a51b14-39d5-30d0-a9e7-4a9188d5084b"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/wrapper.cpython-39-darwin.so"", ""name"" : ""wrapper.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4780044288, ""size"" : 40960, ""uuid"" : ""fb5796bc-2097-34fd-aa9e-ac5ec077ef6f"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/formathandler.cpython-39-darwin.so"", ""name"" : ""formathandler.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4782403584, ""size"" : 32768, ""uuid"" : ""1da0fbf1-6658-3ab0-bfaf-3ecde710627d"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/latebind.cpython-39-darwin.so"", ""name"" : ""latebind.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4780843008, ""size"" : 106496, ""uuid"" : ""988c7ab9-57c2-3f1f-81f6-58afbd09155f"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/vbo.cpython-39-darwin.so"", ""name"" : ""vbo.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4777902080, ""size"" : 32768, ""uuid"" : ""2260e39a-f951-3ccb-a3d0-b5a148b476ef"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqgif.dylib"", ""name"" : ""libqgif.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4781436928, ""size"" : 32768, ""uuid"" : ""73d7bcd4-8546-396d-a967-2b785956402a"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqwbmp.dylib"", ""name"" : ""libqwbmp.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4839370752, ""size"" : 589824, ""uuid"" : ""3b229f97-2736-3600-b112-046517b55a28"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqwebp.dylib"", ""name"" : ""libqwebp.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4838371328, ""size"" : 32768, ""uuid"" : ""4d459091-8414-3dd9-a319-ee4211c41c4f"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqico.dylib"", ""name"" : ""libqico.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4838178816, ""size"" : 32768, ""uuid"" : ""b29450f6-8c13-3f1e-9427-b5575bbd2213"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqmacheif.dylib"", ""name"" : ""libqmacheif.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4840026112, ""size"" : 458752, ""uuid"" : ""151efa3b-6415-3f4d-a2cd-0dda27471d74"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqjpeg.dylib"", ""name"" : ""libqjpeg.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4838453248, ""size"" : 442368, ""uuid"" : ""3d7ed307-a3b4-3412-85bb-f5632e4815f1"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqtiff.dylib"", ""name"" : ""libqtiff.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4838260736, ""size"" : 32768, ""uuid"" : ""fd611473-3a96-3452-9f7f-3dda20d00245"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqsvg.dylib"", ""name"" : ""libqsvg.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4838977536, ""size"" : 245760, ""uuid"" : ""0813164b-4492-302c-869b-1216dcde7f80"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtSvg.framework\/Versions\/A\/QtSvg"", ""name"" : ""QtSvg"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4840742912, ""size"" : 32768, ""uuid"" : ""ce0d663c-e2e6-390b-9ac5-39b3a57677d4"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqpdf.dylib"", ""name"" : ""libqpdf.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4857364480, ""size"" : 8241152, ""uuid"" : ""14700322-295c-3fb7-baf2-c550dfb64888"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/lib\/QtPdf.framework\/Versions\/A\/QtPdf"", ""name"" : ""QtPdf"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4840550400, ""size"" : 32768, ""uuid"" : ""8015e3fa-97c4-3f06-b195-f49611fc1bb3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqicns.dylib"", ""name"" : ""libqicns.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4840632320, ""size"" : 32768, ""uuid"" : ""240d6086-fc62-33e6-ba7a-d165f711e209"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqtga.dylib"", ""name"" : ""libqtga.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4841021440, ""size"" : 32768, ""uuid"" : ""37b5a2dc-1384-3311-8590-292529c94730"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/PyQt6\/Qt6\/plugins\/imageformats\/libqmacjp2.dylib"", ""name"" : ""libqmacjp2.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64h"", ""base"" : 4840824832, ""size"" : 65536, ""uuid"" : ""d2da3b5f-f5ba-3ef1-b99d-bc64a8487401"", ""path"" : ""\/usr\/lib\/libobjc-trampolines.dylib"", ""name"" : ""libobjc-trampolines.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4780158976, ""size"" : 4096, ""uuid"" : ""176a598c-2a97-38a7-82a0-9cee2f55e0b3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/core\/_mac_util.cpython-39-darwin.so"", ""name"" : ""_mac_util.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4855857152, ""size"" : 98304, ""uuid"" : ""b103f1cd-dafd-3f25-a627-7b8fe067937c"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lz4\/_version.cpython-39-darwin.so"", ""name"" : ""_version.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4855545856, ""size"" : 212992, ""uuid"" : ""0a572b0f-7271-319c-9f17-7d1821eaccd7"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lz4\/frame\/_frame.cpython-39-darwin.so"", ""name"" : ""_frame.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4856528896, ""size"" : 143360, ""uuid"" : ""809e113e-a9e6-304f-8c5d-9c998d93032c"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/core\/_serialize.cpython-39-darwin.so"", ""name"" : ""_serialize.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4856819712, ""size"" : 98304, ""uuid"" : ""da802e8c-8946-3174-a88d-c460d9f502f9"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/msgpack\/_cmsgpack.cpython-39-darwin.so"", ""name"" : ""_cmsgpack.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4856160256, ""size"" : 16384, ""uuid"" : ""3b220334-2123-365c-babe-beb387dab5ca"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/numpy\/linalg\/lapack_lite.cpython-39-darwin.so"", ""name"" : ""lapack_lite.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4856004608, ""size"" : 77824, ""uuid"" : ""45e679b6-43af-3a5e-b39a-4521b5380f01"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/atomic\/_ribbons.cpython-39-darwin.so"", ""name"" : ""_ribbons.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4856393728, ""size"" : 20480, ""uuid"" : ""ba973aa3-7e75-3e17-ba66-60209a667b0d"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/graphics\/_graphics.cpython-39-darwin.so"", ""name"" : ""_graphics.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4867407872, ""size"" : 454656, ""uuid"" : ""5a0f30d4-b4ba-316a-8278-78d0c72f5977"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/mmcif\/mmcif.cpython-39-darwin.so"", ""name"" : ""mmcif.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4866048000, ""size"" : 446464, ""uuid"" : ""363f0a7f-8a13-3465-82ee-3a637fe01cc3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/mmcif\/_mmcif.cpython-39-darwin.so"", ""name"" : ""_mmcif.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4857032704, ""size"" : 176128, ""uuid"" : ""5e4388ca-929a-385d-8f7e-4a6c443b3eab"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/pdb\/_pdbio.cpython-39-darwin.so"", ""name"" : ""_pdbio.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4873232384, ""size"" : 1646592, ""uuid"" : ""f6715553-8e55-3558-821f-aa3230c76581"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lxml\/etree.cpython-39-darwin.so"", ""name"" : ""etree.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4868669440, ""size"" : 139264, ""uuid"" : ""39a3906c-1e68-3b4d-b78b-0ba3a985c514"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/lxml\/_elementpath.cpython-39-darwin.so"", ""name"" : ""_elementpath.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4872634368, ""CFBundleShortVersionString"" : ""3.0"", ""CFBundleIdentifier"" : ""com.apple.security.csparser"", ""size"" : 98304, ""uuid"" : ""26a4d257-e0f8-3d9b-be1c-3346667a17ba"", ""path"" : ""\/System\/Library\/Frameworks\/Security.framework\/Versions\/A\/PlugIns\/csparser.bundle\/Contents\/MacOS\/csparser"", ""name"" : ""csparser"", ""CFBundleVersion"" : ""60420.101.4"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4944519168, ""size"" : 69632, ""uuid"" : ""945a985a-b909-351d-bdab-7b4cc3abe896"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/numpy_formathandler.cpython-39-darwin.so"", ""name"" : ""numpy_formathandler.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4952010752, ""size"" : 24576, ""uuid"" : ""31758f9e-950f-3dd3-aabd-b4f95f7234e3"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/OpenGL_accelerate\/nones_formathandler.cpython-39-darwin.so"", ""name"" : ""nones_formathandler.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4958318592, ""size"" : 16384, ""uuid"" : ""b3a28b9e-f2e7-30be-b15e-275f4f68c91b"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/alignment_algs\/_sw.cpython-39-darwin.so"", ""name"" : ""_sw.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4973678592, ""size"" : 4096, ""uuid"" : ""e1f9fc84-3b63-3ab7-b6d9-8a3d7a31082f"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/alignment_algs\/libalign_algs.dylib"", ""name"" : ""libalign_algs.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4973522944, ""size"" : 28672, ""uuid"" : ""b3fdf741-e64a-382d-829e-9788a9d976e1"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/site-packages\/chimerax\/alignment_algs\/_nw.cpython-39-darwin.so"", ""name"" : ""_nw.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 4702883840, ""size"" : 8192, ""uuid"" : ""9e241d8d-ee83-3dfd-aa89-fd7a71a7d9de"", ""path"" : ""\/Applications\/ChimeraX-1.6.1.app\/Contents\/Library\/Frameworks\/Python.framework\/Versions\/3.9\/lib\/python3.9\/lib-dynload\/_multiprocessing.cpython-39-darwin.so"", ""name"" : ""_multiprocessing.cpython-39-darwin.so"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703508766720, ""size"" : 237560, ""uuid"" : ""08606a44-7008-3658-9f00-6c250b80e9c3"", ""path"" : ""\/usr\/lib\/system\/libsystem_kernel.dylib"", ""name"" : ""libsystem_kernel.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703509004288, ""size"" : 49152, ""uuid"" : ""86dfa543-95fa-36b4-83c6-bf03d01b2aad"", ""path"" : ""\/usr\/lib\/system\/libsystem_pthread.dylib"", ""name"" : ""libsystem_pthread.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703507615744, ""size"" : 557048, ""uuid"" : ""0773ddbc-707e-3b56-ad3e-97aaa9b2c3ed"", ""path"" : ""\/usr\/lib\/system\/libsystem_c.dylib"", ""name"" : ""libsystem_c.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703509200896, ""size"" : 40944, ""uuid"" : ""c99e2bcf-5fa3-3690-9f4b-5e9a08b57343"", ""path"" : ""\/usr\/lib\/system\/libsystem_platform.dylib"", ""name"" : ""libsystem_platform.dylib"" }, { ""size"" : 0, ""source"" : ""A"", ""base"" : 0, ""uuid"" : ""00000000-0000-0000-0000-000000000000"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703589146624, ""CFBundleShortVersionString"" : ""1.600.0"", ""CFBundleIdentifier"" : ""com.apple.SkyLight"", ""size"" : 4132859, ""uuid"" : ""d13830de-e60f-353f-948c-8d4adfdbc698"", ""path"" : ""\/System\/Library\/PrivateFrameworks\/SkyLight.framework\/Versions\/A\/SkyLight"", ""name"" : ""SkyLight"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703507308544, ""size"" : 294900, ""uuid"" : ""c03e068c-2b62-3aed-9358-e0aa79ff7851"", ""path"" : ""\/usr\/lib\/system\/libdispatch.dylib"", ""name"" : ""libdispatch.dylib"" }, { ""source"" : ""P"", ""arch"" : ""x86_64h"", ""base"" : 140703509417984, ""CFBundleShortVersionString"" : ""6.9"", ""CFBundleIdentifier"" : ""com.apple.CoreFoundation"", ""size"" : 4837360, ""uuid"" : ""315a3f65-0954-3635-96dc-2f65c691d074"", ""path"" : ""\/System\/Library\/Frameworks\/CoreFoundation.framework\/Versions\/A\/CoreFoundation"", ""name"" : ""CoreFoundation"", ""CFBundleVersion"" : ""1971"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703671640064, ""CFBundleShortVersionString"" : ""2.1.1"", ""CFBundleIdentifier"" : ""com.apple.HIToolbox"", ""size"" : 3112958, ""uuid"" : ""a6003e8b-72cc-3d98-b569-26102836c61f"", ""path"" : ""\/System\/Library\/Frameworks\/Carbon.framework\/Versions\/A\/Frameworks\/HIToolbox.framework\/Versions\/A\/HIToolbox"", ""name"" : ""HIToolbox"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703560597504, ""CFBundleShortVersionString"" : ""6.9"", ""CFBundleIdentifier"" : ""com.apple.AppKit"", ""size"" : 16809969, ""uuid"" : ""af96f40f-d333-3647-9da4-eddc52df4753"", ""path"" : ""\/System\/Library\/Frameworks\/AppKit.framework\/Versions\/C\/AppKit"", ""name"" : ""AppKit"", ""CFBundleVersion"" : ""2299.50.120"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703505489920, ""size"" : 624040, ""uuid"" : ""f22a1143-9732-3e23-a8b7-cbade6bb8301"", ""path"" : ""\/usr\/lib\/dyld"", ""name"" : ""dyld"" }, { ""source"" : ""P"", ""arch"" : ""x86_64"", ""base"" : 140703524782080, ""CFBundleShortVersionString"" : ""6.9"", ""CFBundleIdentifier"" : ""com.apple.Foundation"", ""size"" : 9998329, ""uuid"" : ""b2777f39-79a2-3f29-849d-99acb74e4a12"", ""path"" : ""\/System\/Library\/Frameworks\/Foundation.framework\/Versions\/C\/Foundation"", ""name"" : ""Foundation"", ""CFBundleVersion"" : ""1971"" } ], ""sharedCache"" : { ""base"" : 140703504867328, ""size"" : 21474836480, ""uuid"" : ""5dd9a20c-1502-31aa-84b0-1cda4c95765b"" }, ""vmSummary"" : ""ReadOnly portion of Libraries: Total=1.1G resident=0K(0%) swapped_out_or_unallocated=1.1G(100%)\nWritable regions: Total=13.7G written=0K(0%) resident=0K(0%) swapped_out=0K(0%) unallocated=13.7G(100%)\n\n VIRTUAL REGION \nREGION TYPE SIZE COUNT (non-coalesced) \n=========== ======= ======= \nAccelerate framework 256K 2 \nActivity Tracing 256K 1 \nCG backing stores 7476K 13 \nCG image 256K 39 \nColorSync 264K 29 \nCoreAnimation 200K 35 \nCoreGraphics 16K 3 \nCoreServices 624K 2 \nCoreUI image data 3532K 42 \nFoundation 32K 2 \nIOKit 15.5M 2 \nKernel Alloc Once 8K 1 \nMALLOC 13.1G 1122 \nMALLOC guard page 32K 8 \nMALLOC_LARGE (reserved) 2580K 2 reserved VM address space (unallocated)\nMALLOC_NANO (reserved) 128.0M 1 reserved VM address space (unallocated)\nMach message 24K 5 \nOpenGL GLSL 384K 4 \nSTACK GUARD 128K 32 \nStack 174.2M 33 \nStack Guard 56.0M 1 \nVM_ALLOCATE 246.2M 161 \n__CTF 824 1 \n__DATA 47.5M 778 \n__DATA_CONST 41.2M 399 \n__DATA_DIRTY 1812K 231 \n__FONT_DATA 2352 1 \n__GLSLBUILTINS 5174K 1 \n__INFO_FILTER 8 1 \n__LINKEDIT 202.6M 153 \n__OBJC_RO 66.2M 1 \n__OBJC_RW 2012K 2 \n__TEXT 947.4M 781 \ndyld private memory 292K 4 \nmapped file 541.3M 94 \nshared memory 3004K 31 \n=========== ======= ======= \nTOTAL 15.5G 4018 \nTOTAL, minus reserved VM space 15.4G 4018 \n"", ""legacyInfo"" : { ""threadTriggered"" : { ""name"" : ""CrBrowserMain"", ""queue"" : ""com.apple.main-thread"" } }, ""logWritingSignature"" : ""4f43ce7d9ca3536aa3f1071a80e255b73fd7adf9"", ""trialInfo"" : { ""rollouts"" : [ { ""rolloutId"" : ""5f72dc58705eff005a46b3a9"", ""factorPackIds"" : { }, ""deploymentId"" : 240000015 }, { ""rolloutId"" : ""60186475825c62000ccf5450"", ""factorPackIds"" : { }, ""deploymentId"" : 240000055 } ], ""experiments"" : [ { ""treatmentId"" : ""c28e4ee6-1b08-4f90-8e05-2809e78310a3"", ""experimentId"" : ""6317d2003d24842ff850182a"", ""deploymentId"" : 400000013 }, { ""treatmentId"" : ""6dd670af-0633-45e4-ae5f-122ae4df02be"", ""experimentId"" : ""64406ba83deb637ac8a04419"", ""deploymentId"" : 900000005 } ] } } ===== Log before crash start ===== UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. > open ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" Log from Thu Jun 8 16:55:49 2023UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. > open ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" Log from Tue Jun 6 16:44:25 2023UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. How to cite UCSF ChimeraX > help help:quickstart > open 2bbv 2bbv title: The refined three-dimensional structure of an insect virus At 2.8 angstroms resolution [more info...] Chain information for 2bbv #1 --- Chain | Description | UniProt A B C | PROTEIN (BLACK BEETLE VIRUS CAPSID PROTEIN) | COAT_BBV 1-363 D E F | PROTEIN (BLACK BEETLE VIRUS CAPSID PROTEIN) | COAT_BBV 364-407 N | RNA (5'-R(*UP*CP*UP*UP*AP*UP*AP*UP*CP*U)-3') | Non-standard residues in 2bbv #1 --- CA — calcium ion 2bbv mmCIF Assemblies --- 1| complete icosahedral assembly 2| icosahedral asymmetric unit 3| icosahedral pentamer 4| icosahedral 23 hexamer 5| icosahedral asymmetric unit, std point frame 6| crystal asymmetric unit, crystal frame > color bychain > style /b stick Changed 2382 atom styles > color /n teal [Repeated 1 time(s)] > hide /c > show /c > hide /n > shown /n Unknown command: shown /n > show /n [Repeated 1 time(s)] > ribbon /c [Repeated 1 time(s)] > ribbon /n > style /n ribbon Expected a keyword > select /N:4@C5' 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select down 201 atoms, 222 bonds, 10 residues, 1 model selected > select down 20 atoms, 21 bonds, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select down 201 atoms, 222 bonds, 10 residues, 1 model selected > select down 20 atoms, 21 bonds, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select down 201 atoms, 222 bonds, 10 residues, 1 model selected > select down 20 atoms, 21 bonds, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select down 201 atoms, 222 bonds, 10 residues, 1 model selected > select down 20 atoms, 21 bonds, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > color sel gold > select clear > color sel gold > select clear > color sel gold > select clear > color sel gold > select clear > color sel red > surface #1 > color /n fromatoms > surface #1 > surface #2 No atoms specified by #2 > surface > surface #1 hide Expected a keyword > hide surfaces #1 Expected ',' or a keyword > hide surfaces > show surfaces > hide surfaces > style solvent sphere Changed 208 atom styles > color solvent red > sym #1 2bbv mmCIF Assemblies --- 1| complete icosahedral assembly| 60 copies of chains A-F,N 2| icosahedral asymmetric unit| 1 copy of chains A-F,N 3| icosahedral pentamer| 5 copies of chains A-F,N 4| icosahedral 23 hexamer| 6 copies of chains A-F,N 5| icosahedral asymmetric unit, std point frame| 1 copy of chains A-F,N 6| crystal asymmetric unit, crystal frame| 5 copies of chains A-F,N > hide #1 models > show #1 > show #1 models > sym #1 assembly 3 newModel false copies false Made 5 graphical clones for 2bbv assembly 3 > sym #1 assembly 1 Made 60 graphical clones for 2bbv assembly 1 > show #!1 models > hide #!1 models > show #!1 models > hide #!1 models > hide #!2 models > show #!2 models > sym #1 assembly 1view Assembly ""1view"" not found, have 1, 2, 3, 4, 5, 6 > view > set bgColor white > set silhouettes true > save /Users/matthewcomstock/Desktop/2bbv.png > movie record > turn y 2 180 > wait 180 > movie encode /Users/matthewcomstock/Desktop/movie1.mp4 Movie saved to /Users/matthewcomstock/Desktop/movie1.mp4 > close #2 > sym #1 assembly 3 newModel false copies false Made 5 graphical clones for 2bbv assembly 3 > show #1 models > view > ui mousemode right zoom > ui mousemode right translate > ui mousemode right zoom > surface #1 > color /n fromatoms > style solvent sphere Changed 208 atom styles > color solvent red > view > close > set bgColor black > set bgColor transparent > set silhouettes false > open 1080 fromDatabase emdb Summary of feedback from opening 1080 fetched from emdb --- note | Fetching compressed map 1080 from ftp://ftp.ebi.ac.uk/pub/databases/emdb/structures/EMD-1080/map/emd_1080.map.gz Opened emdb 1080 as #1, grid size 100,100,100, pixel 2.7, shown at level 1.68, step 1, values float32 > lighting full > volume #1 level 0.9 > volume #1 level .5 > volume #1 level .2 > volume #1 level .1 > volume #1 level 2 > volume #1 level .15 > volume #1 level 1.68 > ui mousemode right ""contour level"" > volume #1 level 1.812 > volume #1 level 1.773 > volume #1 level 1.504 > volume #1 level 1.275 > volume #1 encloseVolume 1e6 step 1 color tan > volume #1 1e5 step 1 Expected a keyword > volume #1 1e5 step 1 color tan Expected a keyword > volume #1 encloseVolume 1e5 step 1 > volume #1 encloseVolume 1e4 step 1 > volume #1 encloseVolume 1e6 step 1 color tan > set bgColor gray > set bgColor #80808000 > set silhouettes true > open 1grl Summary of feedback from opening 1grl fetched from pdb --- note | Fetching compressed mmCIF 1grl from http://files.rcsb.org/download/1grl.cif 1grl title: The crystal structure of the bacterial chaperonin groel At 2.8 angstroms [more info...] Chain information for 1grl #2 --- Chain | Description | UniProt A B C D E F G | GROEL (HSP60 CLASS) | CH60_ECOLI 2-548 1grl mmCIF Assemblies --- 1| author_and_software_defined_assembly 2| software_defined_assembly > lighting default > ui mousemode right zoom > ui mousemode right ""translate selected models"" > select /D:357@CG2 1 atom, 1 residue, 1 model selected > view matrix models #2,1,0,0,44.01,0,1,0,-1.4223,0,0,1,-0.37848 > ui mousemode right ""rotate selected models"" > view matrix models > #2,0.99999,-0.0041909,0.002923,44.116,0.0043018,0.99923,-0.039047,-2.5771,-0.0027571,0.039059,0.99923,-0.57913 > view matrix models > #2,0.99572,-0.092469,0.00020636,43.966,0.092405,0.99494,-0.039468,1.1951,0.0034442,0.039318,0.99922,-0.31382 > fitmap #2 inMap #1 Fit molecule 1grl (#2) to map emdb 1080 (#1) using 29274 atoms average map value = 1.33, steps = 104 shifted from previous position = 0.914 rotated from previous position = 20.7 degrees atoms outside contour = 3707, contour level = 0.82501 Position of 1grl (#2) relative to emdb 1080 (#1) coordinates: Matrix rotation and translation 0.90168809 -0.43225449 -0.01070721 39.38415285 0.43238288 0.90129381 0.02673023 18.93264110 -0.00190392 -0.02873195 0.99958534 -0.07033036 Axis -0.06401015 -0.01016007 0.99789753 Axis point -21.87968789 95.67746379 0.00000000 Rotation angle (degrees) 25.67269007 Shift along axis -2.78352503 > volume #1 transparency 0.5 > view matrix models > #2,0.92048,-0.39074,-0.0062701,40.283,0.39076,0.92009,0.027407,17.143,-0.0049401,-0.027678,0.9996,-0.20146 > fitmap #2 inMap #1 Fit molecule 1grl (#2) to map emdb 1080 (#1) using 29274 atoms average map value = 1.33, steps = 60 shifted from previous position = 0.0354 rotated from previous position = 2.63 degrees atoms outside contour = 3704, contour level = 0.82501 Position of 1grl (#2) relative to emdb 1080 (#1) coordinates: Matrix rotation and translation 0.90160406 -0.43242969 -0.01070914 39.38027615 0.43255808 0.90120994 0.02672371 18.93993563 -0.00190494 -0.02872653 0.99958549 -0.07718132 Axis -0.06397061 -0.01015704 0.99790009 Axis point -21.87911091 95.63336281 0.00000000 Rotation angle (degrees) 25.68378070 Shift along axis -2.78857344 > volume #1 transparency 0.5 > molmap #2 10 Opened 1grl map 10 as #3, grid size 63,63,41, pixel 3.33, shown at level 0.0611, step 1, values float32 > volume #3 style mesh > volume subtract #1 #3 minRms true Opened volume difference as #4, grid size 100,100,100, pixel 2.7, shown at step 1, values float32 Minimum RMS scale factor for ""1grl map 10 #3"" above level 0.061077 is 4.5565 > volume #4 color pink transparency 0 > hide atoms > show ribbons > close > set bgColor black > set bgColor transparent > set silhouettes false > open 1a0m fromDatabase eds Summary of feedback from opening 1a0m fetched from eds --- note | Fetching map 1a0m from http://www.ebi.ac.uk/pdbe/coordinates/files/1a0m.ccp4 Opened eds 1a0m as #1, grid size 97,101,88, pixel 0.37,0.37,0.367, shown at level 2.28, step 1, values float32 > open 1a0m Summary of feedback from opening 1a0m fetched from pdb --- note | Fetching compressed mmCIF 1a0m from http://files.rcsb.org/download/1a0m.cif 1a0m title: 1.1 angstrom crystal structure of A-conotoxin [TYR15]-epi [more info...] Chain information for 1a0m #2 --- Chain | Description | UniProt A B | ALPHA-CONOTOXIN [TYR15]-EPI | CXA1_CONEP 1-16 Non-standard residues in 1a0m #2 --- NH2 — amino group > hide ribbons > show > volume #1 level 1.0 style mesh > ui mousemode right zoom > volume zone #1 nearAtoms #2 range 2 > volume #1 level 0.5 transparency 0.6 > close > open 1273 fromDatabase emdb Summary of feedback from opening 1273 fetched from emdb --- note | Fetching compressed map 1273 from ftp://ftp.ebi.ac.uk/pub/databases/emdb/structures/EMD-1273/map/emd_1273.map.gz Opened emdb 1273 as #1, grid size 2048,2048,76, pixel 22.5, shown at step 1, values int8 > volume #1 region all showOutlineBox true > close > open 7v99 Summary of feedback from opening 7v99 fetched from pdb --- note | Fetching compressed mmCIF 7v99 from http://files.rcsb.org/download/7v99.cif 7v99 title: catalytic core of human telomerase holoenzyme [more info...] Chain information for 7v99 #1 --- Chain | Description | UniProt A | Telomerase reverse transcriptase | TERT_HUMAN 1-1132 K | Histone H2A type 1-B/E | H2A1B_HUMAN 1-129 L | Histone H2B type 1-K | H2B1K_HUMAN 1-125 R | Telomerase RNA component | S | Primer DNA | > color bychain > set bgColor white > set bgColor #ffffff00 > lighting simple > lighting full > hide atoms > show cartoons > show atoms > show surfaces > nucleotides ladder > graphics silhouettes true > volume hide No volumes specified > select /R:33-334 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > hide surfaces sel Expected ',' or a keyword > hide sel surfaces > color sel orange > hide /a > hide /a atoms > hide /a surfaces > hide /a ribbons > hide /s > hide /s all Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > hide /s models [Repeated 1 time(s)] > show /s models > show /s atoms > hide /s atoms > hide /s surfaces > hide /s ribbons > sym #1 7v99 mmCIF Assemblies --- 1| author_defined_assembly| 1 copy of chains A,K,L,R,S > show /a surfaces > color /r teal > color /r orange > color /k green > color /l green > color /k red > hide sel atoms > show sel atoms > color sel bynucleotide > nucleotides sel stubs > nucleotides sel ladder > nucleotides sel stubs > nucleotides sel tube/slab shape muffler > nucleotides sel tube/slab shape ellipsoid > nucleotides sel tube/slab shape box > nucleotides sel slab > style nucleic & sel stick Changed 5156 atom styles > nucleotides sel fill > style nucleic & sel stick Changed 5156 atom styles > nucleotides sel stubs > nucleotides sel ladder > color #1.4 #ff59f5ff > hide /k atoms > hide /l atoms > color #1.5 #00d301ff > color #1.5 #00da01ff > save ""/Users/matthewcomstock/OneDrive - Michigan State University/project > analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera > work.cxs"" > open https://www.rbvi.ucsf.edu/chimerax/tutorials.html Opened https://www.rbvi.ucsf.edu/chimerax/tutorials.html > ui tool show ""Show Sequence Viewer"" > sequence chain /R Alignment identifier is 1/R > select sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > color sel red > color sel orange > save ""/Users/matthewcomstock/OneDrive - Michigan State University/project > analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera > work.cxs"" > ui tool show ""Show Sequence Viewer"" > sequence chain /R Destroying pre-existing alignment with identifier 1/R Alignment identifier is 1/R > select /a 7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected > select /r 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > select /r sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > select sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > select /r 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > select /r :1:10 Nothing selected > select /r:1:10 Nothing selected > select /r:10 Nothing selected > select /r:100 20 atoms, 21 bonds, 1 residue, 1 model selected > select /r:101 20 atoms, 21 bonds, 1 residue, 1 model selected > select /r:237 20 atoms, 21 bonds, 1 residue, 1 model selected > color sel red > color sel green > color /r:334 red > save /Users/matthewcomstock/Desktop/image1.png supersample 3 > hide /r:start-236 > hide ribbons /r:start-236 Expected ',' or a keyword > hide /r:start-236 ribbons > hide /r:335-end atoms, ribbons > show /r:335-end atoms, ribbons > show /r:335-end atoms > show /r:335-end > hide /r:335-end > show /r atoms, ribbons > hide /r atoms, ribbons > show /r atoms, ribbons > hide sequence ggguug atoms, ribbon Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > select /r sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > name trapping_TR sel > name traptr sel > color traptr red > color traptr orange > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > name before_traptr sel > hide before_traptr atoms, ribbons > save /Users/matthewcomstock/Desktop/image1.png supersample 3 > movie record > turn y 2 180 > wait 180 > movie encode /Users/matthewcomstock/Desktop/movie1.mp4 Movie saved to /Users/matthewcomstock/Desktop/movie1.mp4 > save ""/Users/matthewcomstock/OneDrive - Michigan State University/project > analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera > work.cxs"" > cd ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures"" Current working directory is: /Users/matthewcomstock/Library/CloudStorage/OneDrive- MichiganStateUniversity/project analysis/230308 telomerase RNA structure/telomerase structures > select /a 7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected > transparency (#!1 & sel) 50 > show /s atoms, ribbons > color /s red > show before_traptr ribbons > hide before_traptr ribbons > ribbon before_traptr > hide ribbons > show ribbons > hide /a ribbons > hide before_traptr > hide before_traptr ribbons > before_traptr Unknown command: before_traptr > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > hide sel > hide sel ribbons > hide sel ribbons, atoms > show sel ribbons, atoms > hide sel ribbons, atoms > name before_traptr sel > show before_traptr ribbons > show before_traptr ribbons, atoms > hide before_traptr ribbons, atoms > show before_traptr ribbons > show before_traptr ribbons transparency .5 Expected ',' or a keyword > show before_traptr ribbon, transparency .5 Missing or invalid ""what"" argument: Should be one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' > transparancy before_traptr 0.5 Unknown command: transparancy before_traptr 0.5 > select before_traptr 5156 atoms, 3422 bonds, 104 pseudobonds, 243 residues, 3 models selected > transparancy 0.5 Unknown command: transparancy 0.5 > transparency 0.5 > transparency 1 > transparency /a 50 > transparency /a 75 > transparency /a 25 > transparency /a 35 > transparency before_traptr 35 > surface before_traptr > hide surfaces > show /a surfaces > show /k, /l surface Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > show /k or /l surface Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > show /k and /l surface Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > show /l surfaces > show /k surfaces > hide before_traptr > hide traptr > hide traptr ribbons > hide traptr ribbons, atoms > show traptr ribbons, atoms > /r > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg Unknown command: sequence /r ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg > select sequence /r > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg Expected a keyword > select /r sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > name traptr /r sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg ""/r sequence ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg"": contains extra trailing text > name traptr sel > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > name before_traptr sel > hide before_traptr > hide before_traptr atoms, ribbons > hide traptr atoms, ribbons > lighting soft > lighting simple > lighting full > lighting simple > show /r:33:147 > show /r:33-147 > show /r:33-137 > show /r:33-147 > hide /r:33-147 > select /r:237-334 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > name traptr sel > hide traptr > hide traptr atoms, ribbons > show traptr atoms, ribbons > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > select /r:163-192 643 atoms, 720 bonds, 30 residues, 1 model selected > name beforetr1 sel > show beforetr1 atoms, ribbons > hide beforetr1 atoms, ribbons > hide traptr atoms, ribbons [Repeated 1 time(s)] > hide traptr > select /r:237-334 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > select /r:33-147 2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected > show /r:33-147 > hide /r:33-147 > select /r:33-147 2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected > name test1 sel > show test1 > hide test1 > select test1 5156 atoms, 2702 bonds, 59 pseudobonds, 243 residues, 2 models selected > select /r:33-147 2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected > name beforetraptr1 ""beforetraptr1"" is not defined > name beforetraptr1 sel > show beforetraptr1 > hide beforetraptr1 > show beforetraptr1 atoms, ribbons > hide beforetraptr1 atoms, ribbons > show beforetraptr1 atoms, ribbons > show beforetraptr1 atoms, ribbons, surfaces > hide beforetraptr1 atoms, ribbons > color beforetraptr1 teal > hide beforetraptr1 surfaces > show beforetraptr1 atoms, ribbons > transparency beforetraptr1 50 target all > transparency beforetraptr1 50 target All Invalid ""target"" argument: Character 'A' is not an allowed target, must be one of acrsbmpfl > transparency beforetraptr1 50 target all > transparency beforetraptr1 10 target all > transparency beforetraptr1 100 target all > color beforetraptr1 red > color beforetraptr1 pink > select /r:163-192 643 atoms, 720 bonds, 30 residues, 1 model selected > select /r:163-192 643 atoms, 720 bonds, 30 residues, 1 model selected > name beforetraptr2 sel > show beforetraptr2 atoms, ribbons > color beforetraptr2 pink > save ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" ——— End of log from Tue Jun 6 16:44:25 2023 ——— opened ChimeraX session UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. How to cite UCSF ChimeraX > show traptr ribbons, atoms > hide traptr ribbons, atoms > show traptr ribbons, atoms > color traptr red > info chains chain id /A chain_id A chain id /K chain_id K chain id /L chain_id L chain id /R chain_id R chain id /S chain_id S > info models model id #1 type AtomicStructure name 7v99 model id #1.1 type PseudobondGroup name ""hydrogen bonds"" model id #1.2 type PseudobondGroup name ""missing structure"" model id #1.3 type MolecularSurface name ""7v99_A SES surface"" model id #1.4 type MolecularSurface name ""7v99_K SES surface"" model id #1.5 type MolecularSurface name ""7v99_L SES surface"" model id #1.6 type MolecularSurface name ""7v99_R SES surface"" model id #1.7 type MolecularSurface name ""7v99_S SES surface"" > info selection atom id /R:163@P idatm_type Pac atom id /R:163@OP1 idatm_type O3- atom id /R:163@OP2 idatm_type O3- atom id /R:163@O5' idatm_type O3 atom id /R:163@C5' idatm_type C3 atom id /R:163@C4' idatm_type C3 atom id /R:163@O4' idatm_type O3 atom id /R:163@C3' idatm_type C3 atom id /R:163@O3' idatm_type O3 atom id /R:163@C2' idatm_type C3 atom id /R:163@O2' idatm_type O3 atom id /R:163@C1' idatm_type C3 atom id /R:163@N9 idatm_type Npl atom id /R:163@C8 idatm_type Car atom id /R:163@N7 idatm_type N2 atom id /R:163@C5 idatm_type Car atom id /R:163@C6 idatm_type C2 atom id /R:163@O6 idatm_type O2 atom id /R:163@N1 idatm_type Npl atom id /R:163@C2 idatm_type C2 atom id /R:163@N2 idatm_type Npl atom id /R:163@N3 idatm_type N2 atom id /R:163@C4 idatm_type Car atom id /R:164@P idatm_type Pac atom id /R:164@OP1 idatm_type O3- atom id /R:164@OP2 idatm_type O3- atom id /R:164@O5' idatm_type O3 atom id /R:164@C5' idatm_type C3 atom id /R:164@C4' idatm_type C3 atom id /R:164@O4' idatm_type O3 atom id /R:164@C3' idatm_type C3 atom id /R:164@O3' idatm_type O3 atom id /R:164@C2' idatm_type C3 atom id /R:164@O2' idatm_type O3 atom id /R:164@C1' idatm_type C3 atom id /R:164@N9 idatm_type Npl atom id /R:164@C8 idatm_type Car atom id /R:164@N7 idatm_type N2 atom id /R:164@C5 idatm_type Car atom id /R:164@C6 idatm_type Car atom id /R:164@N6 idatm_type Npl atom id /R:164@N1 idatm_type N2 atom id /R:164@C2 idatm_type Car atom id /R:164@N3 idatm_type N2 atom id /R:164@C4 idatm_type Car atom id /R:165@P idatm_type Pac atom id /R:165@OP1 idatm_type O3- atom id /R:165@OP2 idatm_type O3- atom id /R:165@O5' idatm_type O3 atom id /R:165@C5' idatm_type C3 atom id /R:165@C4' idatm_type C3 atom id /R:165@O4' idatm_type O3 atom id /R:165@C3' idatm_type C3 atom id /R:165@O3' idatm_type O3 atom id /R:165@C2' idatm_type C3 atom id /R:165@O2' idatm_type O3 atom id /R:165@C1' idatm_type C3 atom id /R:165@N9 idatm_type Npl atom id /R:165@C8 idatm_type Car atom id /R:165@N7 idatm_type N2 atom id /R:165@C5 idatm_type Car atom id /R:165@C6 idatm_type C2 atom id /R:165@O6 idatm_type O2 atom id /R:165@N1 idatm_type Npl atom id /R:165@C2 idatm_type C2 atom id /R:165@N2 idatm_type Npl atom id /R:165@N3 idatm_type N2 atom id /R:165@C4 idatm_type Car atom id /R:166@P idatm_type Pac atom id /R:166@OP1 idatm_type O3- atom id /R:166@OP2 idatm_type O3- atom id /R:166@O5' idatm_type O3 atom id /R:166@C5' idatm_type C3 atom id /R:166@C4' idatm_type C3 atom id /R:166@O4' idatm_type O3 atom id /R:166@C3' idatm_type C3 atom id /R:166@O3' idatm_type O3 atom id /R:166@C2' idatm_type C3 atom id /R:166@O2' idatm_type O3 atom id /R:166@C1' idatm_type C3 atom id /R:166@N1 idatm_type Npl atom id /R:166@C2 idatm_type C2 atom id /R:166@O2 idatm_type O2 atom id /R:166@N3 idatm_type N2 atom id /R:166@C4 idatm_type C2 atom id /R:166@N4 idatm_type Npl atom id /R:166@C5 idatm_type C2 atom id /R:166@C6 idatm_type C2 atom id /R:167@P idatm_type Pac atom id /R:167@OP1 idatm_type O3- atom id /R:167@OP2 idatm_type O3- atom id /R:167@O5' idatm_type O3 atom id /R:167@C5' idatm_type C3 atom id /R:167@C4' idatm_type C3 atom id /R:167@O4' idatm_type O3 atom id /R:167@C3' idatm_type C3 atom id /R:167@O3' idatm_type O3 atom id /R:167@C2' idatm_type C3 atom id /R:167@O2' idatm_type O3 atom id /R:167@C1' idatm_type C3 atom id /R:167@N9 idatm_type Npl atom id /R:167@C8 idatm_type Car atom id /R:167@N7 idatm_type N2 atom id /R:167@C5 idatm_type Car atom id /R:167@C6 idatm_type Car atom id /R:167@N6 idatm_type Npl atom id /R:167@N1 idatm_type N2 atom id /R:167@C2 idatm_type Car atom id /R:167@N3 idatm_type N2 atom id /R:167@C4 idatm_type Car atom id /R:168@P idatm_type Pac atom id /R:168@OP1 idatm_type O3- atom id /R:168@OP2 idatm_type O3- atom id /R:168@O5' idatm_type O3 atom id /R:168@C5' idatm_type C3 atom id /R:168@C4' idatm_type C3 atom id /R:168@O4' idatm_type O3 atom id /R:168@C3' idatm_type C3 atom id /R:168@O3' idatm_type O3 atom id /R:168@C2' idatm_type C3 atom id /R:168@O2' idatm_type O3 atom id /R:168@C1' idatm_type C3 atom id /R:168@N9 idatm_type Npl atom id /R:168@C8 idatm_type Car atom id /R:168@N7 idatm_type N2 atom id /R:168@C5 idatm_type Car atom id /R:168@C6 idatm_type Car atom id /R:168@N6 idatm_type Npl atom id /R:168@N1 idatm_type N2 atom id /R:168@C2 idatm_type Car atom id /R:168@N3 idatm_type N2 atom id /R:168@C4 idatm_type Car atom id /R:169@P idatm_type Pac atom id /R:169@OP1 idatm_type O3- atom id /R:169@OP2 idatm_type O3- atom id /R:169@O5' idatm_type O3 atom id /R:169@C5' idatm_type C3 atom id /R:169@C4' idatm_type C3 atom id /R:169@O4' idatm_type O3 atom id /R:169@C3' idatm_type C3 atom id /R:169@O3' idatm_type O3 atom id /R:169@C2' idatm_type C3 atom id /R:169@O2' idatm_type O3 atom id /R:169@C1' idatm_type C3 atom id /R:169@N9 idatm_type Npl atom id /R:169@C8 idatm_type Car atom id /R:169@N7 idatm_type N2 atom id /R:169@C5 idatm_type Car atom id /R:169@C6 idatm_type Car atom id /R:169@N6 idatm_type Npl atom id /R:169@N1 idatm_type N2 atom id /R:169@C2 idatm_type Car atom id /R:169@N3 idatm_type N2 atom id /R:169@C4 idatm_type Car atom id /R:170@P idatm_type Pac atom id /R:170@OP1 idatm_type O3- atom id /R:170@OP2 idatm_type O3- atom id /R:170@O5' idatm_type O3 atom id /R:170@C5' idatm_type C3 atom id /R:170@C4' idatm_type C3 atom id /R:170@O4' idatm_type O3 atom id /R:170@C3' idatm_type C3 atom id /R:170@O3' idatm_type O3 atom id /R:170@C2' idatm_type C3 atom id /R:170@O2' idatm_type O3 atom id /R:170@C1' idatm_type C3 atom id /R:170@N1 idatm_type Npl atom id /R:170@C2 idatm_type C2 atom id /R:170@O2 idatm_type O2 atom id /R:170@N3 idatm_type N2 atom id /R:170@C4 idatm_type C2 atom id /R:170@N4 idatm_type Npl atom id /R:170@C5 idatm_type C2 atom id /R:170@C6 idatm_type C2 atom id /R:171@P idatm_type Pac atom id /R:171@OP1 idatm_type O3- atom id /R:171@OP2 idatm_type O3- atom id /R:171@O5' idatm_type O3 atom id /R:171@C5' idatm_type C3 atom id /R:171@C4' idatm_type C3 atom id /R:171@O4' idatm_type O3 atom id /R:171@C3' idatm_type C3 atom id /R:171@O3' idatm_type O3 atom id /R:171@C2' idatm_type C3 atom id /R:171@O2' idatm_type O3 atom id /R:171@C1' idatm_type C3 atom id /R:171@N9 idatm_type Npl atom id /R:171@C8 idatm_type Car atom id /R:171@N7 idatm_type N2 atom id /R:171@C5 idatm_type Car atom id /R:171@C6 idatm_type Car atom id /R:171@N6 idatm_type Npl atom id /R:171@N1 idatm_type N2 atom id /R:171@C2 idatm_type Car atom id /R:171@N3 idatm_type N2 atom id /R:171@C4 idatm_type Car atom id /R:172@P idatm_type Pac atom id /R:172@OP1 idatm_type O3- atom id /R:172@OP2 idatm_type O3- atom id /R:172@O5' idatm_type O3 atom id /R:172@C5' idatm_type C3 atom id /R:172@C4' idatm_type C3 atom id /R:172@O4' idatm_type O3 atom id /R:172@C3' idatm_type C3 atom id /R:172@O3' idatm_type O3 atom id /R:172@C2' idatm_type C3 atom id /R:172@O2' idatm_type O3 atom id /R:172@C1' idatm_type C3 atom id /R:172@N9 idatm_type Npl atom id /R:172@C8 idatm_type Car atom id /R:172@N7 idatm_type N2 atom id /R:172@C5 idatm_type Car atom id /R:172@C6 idatm_type Car atom id /R:172@N6 idatm_type Npl atom id /R:172@N1 idatm_type N2 atom id /R:172@C2 idatm_type Car atom id /R:172@N3 idatm_type N2 atom id /R:172@C4 idatm_type Car atom id /R:173@P idatm_type Pac atom id /R:173@OP1 idatm_type O3- atom id /R:173@OP2 idatm_type O3- atom id /R:173@O5' idatm_type O3 atom id /R:173@C5' idatm_type C3 atom id /R:173@C4' idatm_type C3 atom id /R:173@O4' idatm_type O3 atom id /R:173@C3' idatm_type C3 atom id /R:173@O3' idatm_type O3 atom id /R:173@C2' idatm_type C3 atom id /R:173@O2' idatm_type O3 atom id /R:173@C1' idatm_type C3 atom id /R:173@N9 idatm_type Npl atom id /R:173@C8 idatm_type Car atom id /R:173@N7 idatm_type N2 atom id /R:173@C5 idatm_type Car atom id /R:173@C6 idatm_type Car atom id /R:173@N6 idatm_type Npl atom id /R:173@N1 idatm_type N2 atom id /R:173@C2 idatm_type Car atom id /R:173@N3 idatm_type N2 atom id /R:173@C4 idatm_type Car atom id /R:174@P idatm_type Pac atom id /R:174@OP1 idatm_type O3- atom id /R:174@OP2 idatm_type O3- atom id /R:174@O5' idatm_type O3 atom id /R:174@C5' idatm_type C3 atom id /R:174@C4' idatm_type C3 atom id /R:174@O4' idatm_type O3 atom id /R:174@C3' idatm_type C3 atom id /R:174@O3' idatm_type O3 atom id /R:174@C2' idatm_type C3 atom id /R:174@O2' idatm_type O3 atom id /R:174@C1' idatm_type C3 atom id /R:174@N9 idatm_type Npl atom id /R:174@C8 idatm_type Car atom id /R:174@N7 idatm_type N2 atom id /R:174@C5 idatm_type Car atom id /R:174@C6 idatm_type Car atom id /R:174@N6 idatm_type Npl atom id /R:174@N1 idatm_type N2 atom id /R:174@C2 idatm_type Car atom id /R:174@N3 idatm_type N2 atom id /R:174@C4 idatm_type Car atom id /R:175@P idatm_type Pac atom id /R:175@OP1 idatm_type O3- atom id /R:175@OP2 idatm_type O3- atom id /R:175@O5' idatm_type O3 atom id /R:175@C5' idatm_type C3 atom id /R:175@C4' idatm_type C3 atom id /R:175@O4' idatm_type O3 atom id /R:175@C3' idatm_type C3 atom id /R:175@O3' idatm_type O3 atom id /R:175@C2' idatm_type C3 atom id /R:175@O2' idatm_type O3 atom id /R:175@C1' idatm_type C3 atom id /R:175@N9 idatm_type Npl atom id /R:175@C8 idatm_type Car atom id /R:175@N7 idatm_type N2 atom id /R:175@C5 idatm_type Car atom id /R:175@C6 idatm_type Car atom id /R:175@N6 idatm_type Npl atom id /R:175@N1 idatm_type N2 atom id /R:175@C2 idatm_type Car atom id /R:175@N3 idatm_type N2 atom id /R:175@C4 idatm_type Car atom id /R:176@P idatm_type Pac atom id /R:176@OP1 idatm_type O3- atom id /R:176@OP2 idatm_type O3- atom id /R:176@O5' idatm_type O3 atom id /R:176@C5' idatm_type C3 atom id /R:176@C4' idatm_type C3 atom id /R:176@O4' idatm_type O3 atom id /R:176@C3' idatm_type C3 atom id /R:176@O3' idatm_type O3 atom id /R:176@C2' idatm_type C3 atom id /R:176@O2' idatm_type O3 atom id /R:176@C1' idatm_type C3 atom id /R:176@N9 idatm_type Npl atom id /R:176@C8 idatm_type Car atom id /R:176@N7 idatm_type N2 atom id /R:176@C5 idatm_type Car atom id /R:176@C6 idatm_type Car atom id /R:176@N6 idatm_type Npl atom id /R:176@N1 idatm_type N2 atom id /R:176@C2 idatm_type Car atom id /R:176@N3 idatm_type N2 atom id /R:176@C4 idatm_type Car atom id /R:177@P idatm_type Pac atom id /R:177@OP1 idatm_type O3- atom id /R:177@OP2 idatm_type O3- atom id /R:177@O5' idatm_type O3 atom id /R:177@C5' idatm_type C3 atom id /R:177@C4' idatm_type C3 atom id /R:177@O4' idatm_type O3 atom id /R:177@C3' idatm_type C3 atom id /R:177@O3' idatm_type O3 atom id /R:177@C2' idatm_type C3 atom id /R:177@O2' idatm_type O3 atom id /R:177@C1' idatm_type C3 atom id /R:177@N1 idatm_type Npl atom id /R:177@C2 idatm_type C2 atom id /R:177@O2 idatm_type O2 atom id /R:177@N3 idatm_type Npl atom id /R:177@C4 idatm_type C2 atom id /R:177@O4 idatm_type O2 atom id /R:177@C5 idatm_type C2 atom id /R:177@C6 idatm_type C2 atom id /R:178@P idatm_type Pac atom id /R:178@OP1 idatm_type O3- atom id /R:178@OP2 idatm_type O3- atom id /R:178@O5' idatm_type O3 atom id /R:178@C5' idatm_type C3 atom id /R:178@C4' idatm_type C3 atom id /R:178@O4' idatm_type O3 atom id /R:178@C3' idatm_type C3 atom id /R:178@O3' idatm_type O3 atom id /R:178@C2' idatm_type C3 atom id /R:178@O2' idatm_type O3 atom id /R:178@C1' idatm_type C3 atom id /R:178@N9 idatm_type Npl atom id /R:178@C8 idatm_type Car atom id /R:178@N7 idatm_type N2 atom id /R:178@C5 idatm_type Car atom id /R:178@C6 idatm_type C2 atom id /R:178@O6 idatm_type O2 atom id /R:178@N1 idatm_type Npl atom id /R:178@C2 idatm_type C2 atom id /R:178@N2 idatm_type Npl atom id /R:178@N3 idatm_type N2 atom id /R:178@C4 idatm_type Car atom id /R:179@P idatm_type Pac atom id /R:179@OP1 idatm_type O3- atom id /R:179@OP2 idatm_type O3- atom id /R:179@O5' idatm_type O3 atom id /R:179@C5' idatm_type C3 atom id /R:179@C4' idatm_type C3 atom id /R:179@O4' idatm_type O3 atom id /R:179@C3' idatm_type C3 atom id /R:179@O3' idatm_type O3 atom id /R:179@C2' idatm_type C3 atom id /R:179@O2' idatm_type O3 atom id /R:179@C1' idatm_type C3 atom id /R:179@N1 idatm_type Npl atom id /R:179@C2 idatm_type C2 atom id /R:179@O2 idatm_type O2 atom id /R:179@N3 idatm_type Npl atom id /R:179@C4 idatm_type C2 atom id /R:179@O4 idatm_type O2 atom id /R:179@C5 idatm_type C2 atom id /R:179@C6 idatm_type C2 atom id /R:180@P idatm_type Pac atom id /R:180@OP1 idatm_type O3- atom id /R:180@OP2 idatm_type O3- atom id /R:180@O5' idatm_type O3 atom id /R:180@C5' idatm_type C3 atom id /R:180@C4' idatm_type C3 atom id /R:180@O4' idatm_type O3 atom id /R:180@C3' idatm_type C3 atom id /R:180@O3' idatm_type O3 atom id /R:180@C2' idatm_type C3 atom id /R:180@O2' idatm_type O3 atom id /R:180@C1' idatm_type C3 atom id /R:180@N1 idatm_type Npl atom id /R:180@C2 idatm_type C2 atom id /R:180@O2 idatm_type O2 atom id /R:180@N3 idatm_type N2 atom id /R:180@C4 idatm_type C2 atom id /R:180@N4 idatm_type Npl atom id /R:180@C5 idatm_type C2 atom id /R:180@C6 idatm_type C2 atom id /R:181@P idatm_type Pac atom id /R:181@OP1 idatm_type O3- atom id /R:181@OP2 idatm_type O3- atom id /R:181@O5' idatm_type O3 atom id /R:181@C5' idatm_type C3 atom id /R:181@C4' idatm_type C3 atom id /R:181@O4' idatm_type O3 atom id /R:181@C3' idatm_type C3 atom id /R:181@O3' idatm_type O3 atom id /R:181@C2' idatm_type C3 atom id /R:181@O2' idatm_type O3 atom id /R:181@C1' idatm_type C3 atom id /R:181@N9 idatm_type Npl atom id /R:181@C8 idatm_type Car atom id /R:181@N7 idatm_type N2 atom id /R:181@C5 idatm_type Car atom id /R:181@C6 idatm_type Car atom id /R:181@N6 idatm_type Npl atom id /R:181@N1 idatm_type N2 atom id /R:181@C2 idatm_type Car atom id /R:181@N3 idatm_type N2 atom id /R:181@C4 idatm_type Car atom id /R:182@P idatm_type Pac atom id /R:182@OP1 idatm_type O3- atom id /R:182@OP2 idatm_type O3- atom id /R:182@O5' idatm_type O3 atom id /R:182@C5' idatm_type C3 atom id /R:182@C4' idatm_type C3 atom id /R:182@O4' idatm_type O3 atom id /R:182@C3' idatm_type C3 atom id /R:182@O3' idatm_type O3 atom id /R:182@C2' idatm_type C3 atom id /R:182@O2' idatm_type O3 atom id /R:182@C1' idatm_type C3 atom id /R:182@N9 idatm_type Npl atom id /R:182@C8 idatm_type Car atom id /R:182@N7 idatm_type N2 atom id /R:182@C5 idatm_type Car atom id /R:182@C6 idatm_type C2 atom id /R:182@O6 idatm_type O2 atom id /R:182@N1 idatm_type Npl atom id /R:182@C2 idatm_type C2 atom id /R:182@N2 idatm_type Npl atom id /R:182@N3 idatm_type N2 atom id /R:182@C4 idatm_type Car atom id /R:183@P idatm_type Pac atom id /R:183@OP1 idatm_type O3- atom id /R:183@OP2 idatm_type O3- atom id /R:183@O5' idatm_type O3 atom id /R:183@C5' idatm_type C3 atom id /R:183@C4' idatm_type C3 atom id /R:183@O4' idatm_type O3 atom id /R:183@C3' idatm_type C3 atom id /R:183@O3' idatm_type O3 atom id /R:183@C2' idatm_type C3 atom id /R:183@O2' idatm_type O3 atom id /R:183@C1' idatm_type C3 atom id /R:183@N1 idatm_type Npl atom id /R:183@C2 idatm_type C2 atom id /R:183@O2 idatm_type O2 atom id /R:183@N3 idatm_type N2 atom id /R:183@C4 idatm_type C2 atom id /R:183@N4 idatm_type Npl atom id /R:183@C5 idatm_type C2 atom id /R:183@C6 idatm_type C2 atom id /R:184@P idatm_type Pac atom id /R:184@OP1 idatm_type O3- atom id /R:184@OP2 idatm_type O3- atom id /R:184@O5' idatm_type O3 atom id /R:184@C5' idatm_type C3 atom id /R:184@C4' idatm_type C3 atom id /R:184@O4' idatm_type O3 atom id /R:184@C3' idatm_type C3 atom id /R:184@O3' idatm_type O3 atom id /R:184@C2' idatm_type C3 atom id /R:184@O2' idatm_type O3 atom id /R:184@C1' idatm_type C3 atom id /R:184@N1 idatm_type Npl atom id /R:184@C2 idatm_type C2 atom id /R:184@O2 idatm_type O2 atom id /R:184@N3 idatm_type Npl atom id /R:184@C4 idatm_type C2 atom id /R:184@O4 idatm_type O2 atom id /R:184@C5 idatm_type C2 atom id /R:184@C6 idatm_type C2 atom id /R:185@P idatm_type Pac atom id /R:185@OP1 idatm_type O3- atom id /R:185@OP2 idatm_type O3- atom id /R:185@O5' idatm_type O3 atom id /R:185@C5' idatm_type C3 atom id /R:185@C4' idatm_type C3 atom id /R:185@O4' idatm_type O3 atom id /R:185@C3' idatm_type C3 atom id /R:185@O3' idatm_type O3 atom id /R:185@C2' idatm_type C3 atom id /R:185@O2' idatm_type O3 atom id /R:185@C1' idatm_type C3 atom id /R:185@N9 idatm_type Npl atom id /R:185@C8 idatm_type Car atom id /R:185@N7 idatm_type N2 atom id /R:185@C5 idatm_type Car atom id /R:185@C6 idatm_type C2 atom id /R:185@O6 idatm_type O2 atom id /R:185@N1 idatm_type Npl atom id /R:185@C2 idatm_type C2 atom id /R:185@N2 idatm_type Npl atom id /R:185@N3 idatm_type N2 atom id /R:185@C4 idatm_type Car atom id /R:186@P idatm_type Pac atom id /R:186@OP1 idatm_type O3- atom id /R:186@OP2 idatm_type O3- atom id /R:186@O5' idatm_type O3 atom id /R:186@C5' idatm_type C3 atom id /R:186@C4' idatm_type C3 atom id /R:186@O4' idatm_type O3 atom id /R:186@C3' idatm_type C3 atom id /R:186@O3' idatm_type O3 atom id /R:186@C2' idatm_type C3 atom id /R:186@O2' idatm_type O3 atom id /R:186@C1' idatm_type C3 atom id /R:186@N1 idatm_type Npl atom id /R:186@C2 idatm_type C2 atom id /R:186@O2 idatm_type O2 atom id /R:186@N3 idatm_type N2 atom id /R:186@C4 idatm_type C2 atom id /R:186@N4 idatm_type Npl atom id /R:186@C5 idatm_type C2 atom id /R:186@C6 idatm_type C2 atom id /R:187@P idatm_type Pac atom id /R:187@OP1 idatm_type O3- atom id /R:187@OP2 idatm_type O3- atom id /R:187@O5' idatm_type O3 atom id /R:187@C5' idatm_type C3 atom id /R:187@C4' idatm_type C3 atom id /R:187@O4' idatm_type O3 atom id /R:187@C3' idatm_type C3 atom id /R:187@O3' idatm_type O3 atom id /R:187@C2' idatm_type C3 atom id /R:187@O2' idatm_type O3 atom id /R:187@C1' idatm_type C3 atom id /R:187@N1 idatm_type Npl atom id /R:187@C2 idatm_type C2 atom id /R:187@O2 idatm_type O2 atom id /R:187@N3 idatm_type Npl atom id /R:187@C4 idatm_type C2 atom id /R:187@O4 idatm_type O2 atom id /R:187@C5 idatm_type C2 atom id /R:187@C6 idatm_type C2 atom id /R:188@P idatm_type Pac atom id /R:188@OP1 idatm_type O3- atom id /R:188@OP2 idatm_type O3- atom id /R:188@O5' idatm_type O3 atom id /R:188@C5' idatm_type C3 atom id /R:188@C4' idatm_type C3 atom id /R:188@O4' idatm_type O3 atom id /R:188@C3' idatm_type C3 atom id /R:188@O3' idatm_type O3 atom id /R:188@C2' idatm_type C3 atom id /R:188@O2' idatm_type O3 atom id /R:188@C1' idatm_type C3 atom id /R:188@N9 idatm_type Npl atom id /R:188@C8 idatm_type Car atom id /R:188@N7 idatm_type N2 atom id /R:188@C5 idatm_type Car atom id /R:188@C6 idatm_type C2 atom id /R:188@O6 idatm_type O2 atom id /R:188@N1 idatm_type Npl atom id /R:188@C2 idatm_type C2 atom id /R:188@N2 idatm_type Npl atom id /R:188@N3 idatm_type N2 atom id /R:188@C4 idatm_type Car atom id /R:189@P idatm_type Pac atom id /R:189@OP1 idatm_type O3- atom id /R:189@OP2 idatm_type O3- atom id /R:189@O5' idatm_type O3 atom id /R:189@C5' idatm_type C3 atom id /R:189@C4' idatm_type C3 atom id /R:189@O4' idatm_type O3 atom id /R:189@C3' idatm_type C3 atom id /R:189@O3' idatm_type O3 atom id /R:189@C2' idatm_type C3 atom id /R:189@O2' idatm_type O3 atom id /R:189@C1' idatm_type C3 atom id /R:189@N9 idatm_type Npl atom id /R:189@C8 idatm_type Car atom id /R:189@N7 idatm_type N2 atom id /R:189@C5 idatm_type Car atom id /R:189@C6 idatm_type C2 atom id /R:189@O6 idatm_type O2 atom id /R:189@N1 idatm_type Npl atom id /R:189@C2 idatm_type C2 atom id /R:189@N2 idatm_type Npl atom id /R:189@N3 idatm_type N2 atom id /R:189@C4 idatm_type Car atom id /R:190@P idatm_type Pac atom id /R:190@OP1 idatm_type O3- atom id /R:190@OP2 idatm_type O3- atom id /R:190@O5' idatm_type O3 atom id /R:190@C5' idatm_type C3 atom id /R:190@C4' idatm_type C3 atom id /R:190@O4' idatm_type O3 atom id /R:190@C3' idatm_type C3 atom id /R:190@O3' idatm_type O3 atom id /R:190@C2' idatm_type C3 atom id /R:190@O2' idatm_type O3 atom id /R:190@C1' idatm_type C3 atom id /R:190@N1 idatm_type Npl atom id /R:190@C2 idatm_type C2 atom id /R:190@O2 idatm_type O2 atom id /R:190@N3 idatm_type N2 atom id /R:190@C4 idatm_type C2 atom id /R:190@N4 idatm_type Npl atom id /R:190@C5 idatm_type C2 atom id /R:190@C6 idatm_type C2 atom id /R:191@P idatm_type Pac atom id /R:191@OP1 idatm_type O3- atom id /R:191@OP2 idatm_type O3- atom id /R:191@O5' idatm_type O3 atom id /R:191@C5' idatm_type C3 atom id /R:191@C4' idatm_type C3 atom id /R:191@O4' idatm_type O3 atom id /R:191@C3' idatm_type C3 atom id /R:191@O3' idatm_type O3 atom id /R:191@C2' idatm_type C3 atom id /R:191@O2' idatm_type O3 atom id /R:191@C1' idatm_type C3 atom id /R:191@N1 idatm_type Npl atom id /R:191@C2 idatm_type C2 atom id /R:191@O2 idatm_type O2 atom id /R:191@N3 idatm_type N2 atom id /R:191@C4 idatm_type C2 atom id /R:191@N4 idatm_type Npl atom id /R:191@C5 idatm_type C2 atom id /R:191@C6 idatm_type C2 atom id /R:192@P idatm_type Pac atom id /R:192@OP1 idatm_type O3- atom id /R:192@OP2 idatm_type O3- atom id /R:192@O5' idatm_type O3 atom id /R:192@C5' idatm_type C3 atom id /R:192@C4' idatm_type C3 atom id /R:192@O4' idatm_type O3 atom id /R:192@C3' idatm_type C3 atom id /R:192@O3' idatm_type O3 atom id /R:192@C2' idatm_type C3 atom id /R:192@O2' idatm_type O3 atom id /R:192@C1' idatm_type C3 atom id /R:192@N1 idatm_type Npl atom id /R:192@C2 idatm_type C2 atom id /R:192@O2 idatm_type O2 atom id /R:192@N3 idatm_type N2 atom id /R:192@C4 idatm_type C2 atom id /R:192@N4 idatm_type Npl atom id /R:192@C5 idatm_type C2 atom id /R:192@C6 idatm_type C2 > info selection atom id /R:163@P idatm_type Pac atom id /R:163@OP1 idatm_type O3- atom id /R:163@OP2 idatm_type O3- atom id /R:163@O5' idatm_type O3 atom id /R:163@C5' idatm_type C3 atom id /R:163@C4' idatm_type C3 atom id /R:163@O4' idatm_type O3 atom id /R:163@C3' idatm_type C3 atom id /R:163@O3' idatm_type O3 atom id /R:163@C2' idatm_type C3 atom id /R:163@O2' idatm_type O3 atom id /R:163@C1' idatm_type C3 atom id /R:163@N9 idatm_type Npl atom id /R:163@C8 idatm_type Car atom id /R:163@N7 idatm_type N2 atom id /R:163@C5 idatm_type Car atom id /R:163@C6 idatm_type C2 atom id /R:163@O6 idatm_type O2 atom id /R:163@N1 idatm_type Npl atom id /R:163@C2 idatm_type C2 atom id /R:163@N2 idatm_type Npl atom id /R:163@N3 idatm_type N2 atom id /R:163@C4 idatm_type Car atom id /R:164@P idatm_type Pac atom id /R:164@OP1 idatm_type O3- atom id /R:164@OP2 idatm_type O3- atom id /R:164@O5' idatm_type O3 atom id /R:164@C5' idatm_type C3 atom id /R:164@C4' idatm_type C3 atom id /R:164@O4' idatm_type O3 atom id /R:164@C3' idatm_type C3 atom id /R:164@O3' idatm_type O3 atom id /R:164@C2' idatm_type C3 atom id /R:164@O2' idatm_type O3 atom id /R:164@C1' idatm_type C3 atom id /R:164@N9 idatm_type Npl atom id /R:164@C8 idatm_type Car atom id /R:164@N7 idatm_type N2 atom id /R:164@C5 idatm_type Car atom id /R:164@C6 idatm_type Car atom id /R:164@N6 idatm_type Npl atom id /R:164@N1 idatm_type N2 atom id /R:164@C2 idatm_type Car atom id /R:164@N3 idatm_type N2 atom id /R:164@C4 idatm_type Car atom id /R:165@P idatm_type Pac atom id /R:165@OP1 idatm_type O3- atom id /R:165@OP2 idatm_type O3- atom id /R:165@O5' idatm_type O3 atom id /R:165@C5' idatm_type C3 atom id /R:165@C4' idatm_type C3 atom id /R:165@O4' idatm_type O3 atom id /R:165@C3' idatm_type C3 atom id /R:165@O3' idatm_type O3 atom id /R:165@C2' idatm_type C3 atom id /R:165@O2' idatm_type O3 atom id /R:165@C1' idatm_type C3 atom id /R:165@N9 idatm_type Npl atom id /R:165@C8 idatm_type Car atom id /R:165@N7 idatm_type N2 atom id /R:165@C5 idatm_type Car atom id /R:165@C6 idatm_type C2 atom id /R:165@O6 idatm_type O2 atom id /R:165@N1 idatm_type Npl atom id /R:165@C2 idatm_type C2 atom id /R:165@N2 idatm_type Npl atom id /R:165@N3 idatm_type N2 atom id /R:165@C4 idatm_type Car atom id /R:166@P idatm_type Pac atom id /R:166@OP1 idatm_type O3- atom id /R:166@OP2 idatm_type O3- atom id /R:166@O5' idatm_type O3 atom id /R:166@C5' idatm_type C3 atom id /R:166@C4' idatm_type C3 atom id /R:166@O4' idatm_type O3 atom id /R:166@C3' idatm_type C3 atom id /R:166@O3' idatm_type O3 atom id /R:166@C2' idatm_type C3 atom id /R:166@O2' idatm_type O3 atom id /R:166@C1' idatm_type C3 atom id /R:166@N1 idatm_type Npl atom id /R:166@C2 idatm_type C2 atom id /R:166@O2 idatm_type O2 atom id /R:166@N3 idatm_type N2 atom id /R:166@C4 idatm_type C2 atom id /R:166@N4 idatm_type Npl atom id /R:166@C5 idatm_type C2 atom id /R:166@C6 idatm_type C2 atom id /R:167@P idatm_type Pac atom id /R:167@OP1 idatm_type O3- atom id /R:167@OP2 idatm_type O3- atom id /R:167@O5' idatm_type O3 atom id /R:167@C5' idatm_type C3 atom id /R:167@C4' idatm_type C3 atom id /R:167@O4' idatm_type O3 atom id /R:167@C3' idatm_type C3 atom id /R:167@O3' idatm_type O3 atom id /R:167@C2' idatm_type C3 atom id /R:167@O2' idatm_type O3 atom id /R:167@C1' idatm_type C3 atom id /R:167@N9 idatm_type Npl atom id /R:167@C8 idatm_type Car atom id /R:167@N7 idatm_type N2 atom id /R:167@C5 idatm_type Car atom id /R:167@C6 idatm_type Car atom id /R:167@N6 idatm_type Npl atom id /R:167@N1 idatm_type N2 atom id /R:167@C2 idatm_type Car atom id /R:167@N3 idatm_type N2 atom id /R:167@C4 idatm_type Car atom id /R:168@P idatm_type Pac atom id /R:168@OP1 idatm_type O3- atom id /R:168@OP2 idatm_type O3- atom id /R:168@O5' idatm_type O3 atom id /R:168@C5' idatm_type C3 atom id /R:168@C4' idatm_type C3 atom id /R:168@O4' idatm_type O3 atom id /R:168@C3' idatm_type C3 atom id /R:168@O3' idatm_type O3 atom id /R:168@C2' idatm_type C3 atom id /R:168@O2' idatm_type O3 atom id /R:168@C1' idatm_type C3 atom id /R:168@N9 idatm_type Npl atom id /R:168@C8 idatm_type Car atom id /R:168@N7 idatm_type N2 atom id /R:168@C5 idatm_type Car atom id /R:168@C6 idatm_type Car atom id /R:168@N6 idatm_type Npl atom id /R:168@N1 idatm_type N2 atom id /R:168@C2 idatm_type Car atom id /R:168@N3 idatm_type N2 atom id /R:168@C4 idatm_type Car atom id /R:169@P idatm_type Pac atom id /R:169@OP1 idatm_type O3- atom id /R:169@OP2 idatm_type O3- atom id /R:169@O5' idatm_type O3 atom id /R:169@C5' idatm_type C3 atom id /R:169@C4' idatm_type C3 atom id /R:169@O4' idatm_type O3 atom id /R:169@C3' idatm_type C3 atom id /R:169@O3' idatm_type O3 atom id /R:169@C2' idatm_type C3 atom id /R:169@O2' idatm_type O3 atom id /R:169@C1' idatm_type C3 atom id /R:169@N9 idatm_type Npl atom id /R:169@C8 idatm_type Car atom id /R:169@N7 idatm_type N2 atom id /R:169@C5 idatm_type Car atom id /R:169@C6 idatm_type Car atom id /R:169@N6 idatm_type Npl atom id /R:169@N1 idatm_type N2 atom id /R:169@C2 idatm_type Car atom id /R:169@N3 idatm_type N2 atom id /R:169@C4 idatm_type Car atom id /R:170@P idatm_type Pac atom id /R:170@OP1 idatm_type O3- atom id /R:170@OP2 idatm_type O3- atom id /R:170@O5' idatm_type O3 atom id /R:170@C5' idatm_type C3 atom id /R:170@C4' idatm_type C3 atom id /R:170@O4' idatm_type O3 atom id /R:170@C3' idatm_type C3 atom id /R:170@O3' idatm_type O3 atom id /R:170@C2' idatm_type C3 atom id /R:170@O2' idatm_type O3 atom id /R:170@C1' idatm_type C3 atom id /R:170@N1 idatm_type Npl atom id /R:170@C2 idatm_type C2 atom id /R:170@O2 idatm_type O2 atom id /R:170@N3 idatm_type N2 atom id /R:170@C4 idatm_type C2 atom id /R:170@N4 idatm_type Npl atom id /R:170@C5 idatm_type C2 atom id /R:170@C6 idatm_type C2 atom id /R:171@P idatm_type Pac atom id /R:171@OP1 idatm_type O3- atom id /R:171@OP2 idatm_type O3- atom id /R:171@O5' idatm_type O3 atom id /R:171@C5' idatm_type C3 atom id /R:171@C4' idatm_type C3 atom id /R:171@O4' idatm_type O3 atom id /R:171@C3' idatm_type C3 atom id /R:171@O3' idatm_type O3 atom id /R:171@C2' idatm_type C3 atom id /R:171@O2' idatm_type O3 atom id /R:171@C1' idatm_type C3 atom id /R:171@N9 idatm_type Npl atom id /R:171@C8 idatm_type Car atom id /R:171@N7 idatm_type N2 atom id /R:171@C5 idatm_type Car atom id /R:171@C6 idatm_type Car atom id /R:171@N6 idatm_type Npl atom id /R:171@N1 idatm_type N2 atom id /R:171@C2 idatm_type Car atom id /R:171@N3 idatm_type N2 atom id /R:171@C4 idatm_type Car atom id /R:172@P idatm_type Pac atom id /R:172@OP1 idatm_type O3- atom id /R:172@OP2 idatm_type O3- atom id /R:172@O5' idatm_type O3 atom id /R:172@C5' idatm_type C3 atom id /R:172@C4' idatm_type C3 atom id /R:172@O4' idatm_type O3 atom id /R:172@C3' idatm_type C3 atom id /R:172@O3' idatm_type O3 atom id /R:172@C2' idatm_type C3 atom id /R:172@O2' idatm_type O3 atom id /R:172@C1' idatm_type C3 atom id /R:172@N9 idatm_type Npl atom id /R:172@C8 idatm_type Car atom id /R:172@N7 idatm_type N2 atom id /R:172@C5 idatm_type Car atom id /R:172@C6 idatm_type Car atom id /R:172@N6 idatm_type Npl atom id /R:172@N1 idatm_type N2 atom id /R:172@C2 idatm_type Car atom id /R:172@N3 idatm_type N2 atom id /R:172@C4 idatm_type Car atom id /R:173@P idatm_type Pac atom id /R:173@OP1 idatm_type O3- atom id /R:173@OP2 idatm_type O3- atom id /R:173@O5' idatm_type O3 atom id /R:173@C5' idatm_type C3 atom id /R:173@C4' idatm_type C3 atom id /R:173@O4' idatm_type O3 atom id /R:173@C3' idatm_type C3 atom id /R:173@O3' idatm_type O3 atom id /R:173@C2' idatm_type C3 atom id /R:173@O2' idatm_type O3 atom id /R:173@C1' idatm_type C3 atom id /R:173@N9 idatm_type Npl atom id /R:173@C8 idatm_type Car atom id /R:173@N7 idatm_type N2 atom id /R:173@C5 idatm_type Car atom id /R:173@C6 idatm_type Car atom id /R:173@N6 idatm_type Npl atom id /R:173@N1 idatm_type N2 atom id /R:173@C2 idatm_type Car atom id /R:173@N3 idatm_type N2 atom id /R:173@C4 idatm_type Car atom id /R:174@P idatm_type Pac atom id /R:174@OP1 idatm_type O3- atom id /R:174@OP2 idatm_type O3- atom id /R:174@O5' idatm_type O3 atom id /R:174@C5' idatm_type C3 atom id /R:174@C4' idatm_type C3 atom id /R:174@O4' idatm_type O3 atom id /R:174@C3' idatm_type C3 atom id /R:174@O3' idatm_type O3 atom id /R:174@C2' idatm_type C3 atom id /R:174@O2' idatm_type O3 atom id /R:174@C1' idatm_type C3 atom id /R:174@N9 idatm_type Npl atom id /R:174@C8 idatm_type Car atom id /R:174@N7 idatm_type N2 atom id /R:174@C5 idatm_type Car atom id /R:174@C6 idatm_type Car atom id /R:174@N6 idatm_type Npl atom id /R:174@N1 idatm_type N2 atom id /R:174@C2 idatm_type Car atom id /R:174@N3 idatm_type N2 atom id /R:174@C4 idatm_type Car atom id /R:175@P idatm_type Pac atom id /R:175@OP1 idatm_type O3- atom id /R:175@OP2 idatm_type O3- atom id /R:175@O5' idatm_type O3 atom id /R:175@C5' idatm_type C3 atom id /R:175@C4' idatm_type C3 atom id /R:175@O4' idatm_type O3 atom id /R:175@C3' idatm_type C3 atom id /R:175@O3' idatm_type O3 atom id /R:175@C2' idatm_type C3 atom id /R:175@O2' idatm_type O3 atom id /R:175@C1' idatm_type C3 atom id /R:175@N9 idatm_type Npl atom id /R:175@C8 idatm_type Car atom id /R:175@N7 idatm_type N2 atom id /R:175@C5 idatm_type Car atom id /R:175@C6 idatm_type Car atom id /R:175@N6 idatm_type Npl atom id /R:175@N1 idatm_type N2 atom id /R:175@C2 idatm_type Car atom id /R:175@N3 idatm_type N2 atom id /R:175@C4 idatm_type Car atom id /R:176@P idatm_type Pac atom id /R:176@OP1 idatm_type O3- atom id /R:176@OP2 idatm_type O3- atom id /R:176@O5' idatm_type O3 atom id /R:176@C5' idatm_type C3 atom id /R:176@C4' idatm_type C3 atom id /R:176@O4' idatm_type O3 atom id /R:176@C3' idatm_type C3 atom id /R:176@O3' idatm_type O3 atom id /R:176@C2' idatm_type C3 atom id /R:176@O2' idatm_type O3 atom id /R:176@C1' idatm_type C3 atom id /R:176@N9 idatm_type Npl atom id /R:176@C8 idatm_type Car atom id /R:176@N7 idatm_type N2 atom id /R:176@C5 idatm_type Car atom id /R:176@C6 idatm_type Car atom id /R:176@N6 idatm_type Npl atom id /R:176@N1 idatm_type N2 atom id /R:176@C2 idatm_type Car atom id /R:176@N3 idatm_type N2 atom id /R:176@C4 idatm_type Car atom id /R:177@P idatm_type Pac atom id /R:177@OP1 idatm_type O3- atom id /R:177@OP2 idatm_type O3- atom id /R:177@O5' idatm_type O3 atom id /R:177@C5' idatm_type C3 atom id /R:177@C4' idatm_type C3 atom id /R:177@O4' idatm_type O3 atom id /R:177@C3' idatm_type C3 atom id /R:177@O3' idatm_type O3 atom id /R:177@C2' idatm_type C3 atom id /R:177@O2' idatm_type O3 atom id /R:177@C1' idatm_type C3 atom id /R:177@N1 idatm_type Npl atom id /R:177@C2 idatm_type C2 atom id /R:177@O2 idatm_type O2 atom id /R:177@N3 idatm_type Npl atom id /R:177@C4 idatm_type C2 atom id /R:177@O4 idatm_type O2 atom id /R:177@C5 idatm_type C2 atom id /R:177@C6 idatm_type C2 atom id /R:178@P idatm_type Pac atom id /R:178@OP1 idatm_type O3- atom id /R:178@OP2 idatm_type O3- atom id /R:178@O5' idatm_type O3 atom id /R:178@C5' idatm_type C3 atom id /R:178@C4' idatm_type C3 atom id /R:178@O4' idatm_type O3 atom id /R:178@C3' idatm_type C3 atom id /R:178@O3' idatm_type O3 atom id /R:178@C2' idatm_type C3 atom id /R:178@O2' idatm_type O3 atom id /R:178@C1' idatm_type C3 atom id /R:178@N9 idatm_type Npl atom id /R:178@C8 idatm_type Car atom id /R:178@N7 idatm_type N2 atom id /R:178@C5 idatm_type Car atom id /R:178@C6 idatm_type C2 atom id /R:178@O6 idatm_type O2 atom id /R:178@N1 idatm_type Npl atom id /R:178@C2 idatm_type C2 atom id /R:178@N2 idatm_type Npl atom id /R:178@N3 idatm_type N2 atom id /R:178@C4 idatm_type Car atom id /R:179@P idatm_type Pac atom id /R:179@OP1 idatm_type O3- atom id /R:179@OP2 idatm_type O3- atom id /R:179@O5' idatm_type O3 atom id /R:179@C5' idatm_type C3 atom id /R:179@C4' idatm_type C3 atom id /R:179@O4' idatm_type O3 atom id /R:179@C3' idatm_type C3 atom id /R:179@O3' idatm_type O3 atom id /R:179@C2' idatm_type C3 atom id /R:179@O2' idatm_type O3 atom id /R:179@C1' idatm_type C3 atom id /R:179@N1 idatm_type Npl atom id /R:179@C2 idatm_type C2 atom id /R:179@O2 idatm_type O2 atom id /R:179@N3 idatm_type Npl atom id /R:179@C4 idatm_type C2 atom id /R:179@O4 idatm_type O2 atom id /R:179@C5 idatm_type C2 atom id /R:179@C6 idatm_type C2 atom id /R:180@P idatm_type Pac atom id /R:180@OP1 idatm_type O3- atom id /R:180@OP2 idatm_type O3- atom id /R:180@O5' idatm_type O3 atom id /R:180@C5' idatm_type C3 atom id /R:180@C4' idatm_type C3 atom id /R:180@O4' idatm_type O3 atom id /R:180@C3' idatm_type C3 atom id /R:180@O3' idatm_type O3 atom id /R:180@C2' idatm_type C3 atom id /R:180@O2' idatm_type O3 atom id /R:180@C1' idatm_type C3 atom id /R:180@N1 idatm_type Npl atom id /R:180@C2 idatm_type C2 atom id /R:180@O2 idatm_type O2 atom id /R:180@N3 idatm_type N2 atom id /R:180@C4 idatm_type C2 atom id /R:180@N4 idatm_type Npl atom id /R:180@C5 idatm_type C2 atom id /R:180@C6 idatm_type C2 atom id /R:181@P idatm_type Pac atom id /R:181@OP1 idatm_type O3- atom id /R:181@OP2 idatm_type O3- atom id /R:181@O5' idatm_type O3 atom id /R:181@C5' idatm_type C3 atom id /R:181@C4' idatm_type C3 atom id /R:181@O4' idatm_type O3 atom id /R:181@C3' idatm_type C3 atom id /R:181@O3' idatm_type O3 atom id /R:181@C2' idatm_type C3 atom id /R:181@O2' idatm_type O3 atom id /R:181@C1' idatm_type C3 atom id /R:181@N9 idatm_type Npl atom id /R:181@C8 idatm_type Car atom id /R:181@N7 idatm_type N2 atom id /R:181@C5 idatm_type Car atom id /R:181@C6 idatm_type Car atom id /R:181@N6 idatm_type Npl atom id /R:181@N1 idatm_type N2 atom id /R:181@C2 idatm_type Car atom id /R:181@N3 idatm_type N2 atom id /R:181@C4 idatm_type Car atom id /R:182@P idatm_type Pac atom id /R:182@OP1 idatm_type O3- atom id /R:182@OP2 idatm_type O3- atom id /R:182@O5' idatm_type O3 atom id /R:182@C5' idatm_type C3 atom id /R:182@C4' idatm_type C3 atom id /R:182@O4' idatm_type O3 atom id /R:182@C3' idatm_type C3 atom id /R:182@O3' idatm_type O3 atom id /R:182@C2' idatm_type C3 atom id /R:182@O2' idatm_type O3 atom id /R:182@C1' idatm_type C3 atom id /R:182@N9 idatm_type Npl atom id /R:182@C8 idatm_type Car atom id /R:182@N7 idatm_type N2 atom id /R:182@C5 idatm_type Car atom id /R:182@C6 idatm_type C2 atom id /R:182@O6 idatm_type O2 atom id /R:182@N1 idatm_type Npl atom id /R:182@C2 idatm_type C2 atom id /R:182@N2 idatm_type Npl atom id /R:182@N3 idatm_type N2 atom id /R:182@C4 idatm_type Car atom id /R:183@P idatm_type Pac atom id /R:183@OP1 idatm_type O3- atom id /R:183@OP2 idatm_type O3- atom id /R:183@O5' idatm_type O3 atom id /R:183@C5' idatm_type C3 atom id /R:183@C4' idatm_type C3 atom id /R:183@O4' idatm_type O3 atom id /R:183@C3' idatm_type C3 atom id /R:183@O3' idatm_type O3 atom id /R:183@C2' idatm_type C3 atom id /R:183@O2' idatm_type O3 atom id /R:183@C1' idatm_type C3 atom id /R:183@N1 idatm_type Npl atom id /R:183@C2 idatm_type C2 atom id /R:183@O2 idatm_type O2 atom id /R:183@N3 idatm_type N2 atom id /R:183@C4 idatm_type C2 atom id /R:183@N4 idatm_type Npl atom id /R:183@C5 idatm_type C2 atom id /R:183@C6 idatm_type C2 atom id /R:184@P idatm_type Pac atom id /R:184@OP1 idatm_type O3- atom id /R:184@OP2 idatm_type O3- atom id /R:184@O5' idatm_type O3 atom id /R:184@C5' idatm_type C3 atom id /R:184@C4' idatm_type C3 atom id /R:184@O4' idatm_type O3 atom id /R:184@C3' idatm_type C3 atom id /R:184@O3' idatm_type O3 atom id /R:184@C2' idatm_type C3 atom id /R:184@O2' idatm_type O3 atom id /R:184@C1' idatm_type C3 atom id /R:184@N1 idatm_type Npl atom id /R:184@C2 idatm_type C2 atom id /R:184@O2 idatm_type O2 atom id /R:184@N3 idatm_type Npl atom id /R:184@C4 idatm_type C2 atom id /R:184@O4 idatm_type O2 atom id /R:184@C5 idatm_type C2 atom id /R:184@C6 idatm_type C2 atom id /R:185@P idatm_type Pac atom id /R:185@OP1 idatm_type O3- atom id /R:185@OP2 idatm_type O3- atom id /R:185@O5' idatm_type O3 atom id /R:185@C5' idatm_type C3 atom id /R:185@C4' idatm_type C3 atom id /R:185@O4' idatm_type O3 atom id /R:185@C3' idatm_type C3 atom id /R:185@O3' idatm_type O3 atom id /R:185@C2' idatm_type C3 atom id /R:185@O2' idatm_type O3 atom id /R:185@C1' idatm_type C3 atom id /R:185@N9 idatm_type Npl atom id /R:185@C8 idatm_type Car atom id /R:185@N7 idatm_type N2 atom id /R:185@C5 idatm_type Car atom id /R:185@C6 idatm_type C2 atom id /R:185@O6 idatm_type O2 atom id /R:185@N1 idatm_type Npl atom id /R:185@C2 idatm_type C2 atom id /R:185@N2 idatm_type Npl atom id /R:185@N3 idatm_type N2 atom id /R:185@C4 idatm_type Car atom id /R:186@P idatm_type Pac atom id /R:186@OP1 idatm_type O3- atom id /R:186@OP2 idatm_type O3- atom id /R:186@O5' idatm_type O3 atom id /R:186@C5' idatm_type C3 atom id /R:186@C4' idatm_type C3 atom id /R:186@O4' idatm_type O3 atom id /R:186@C3' idatm_type C3 atom id /R:186@O3' idatm_type O3 atom id /R:186@C2' idatm_type C3 atom id /R:186@O2' idatm_type O3 atom id /R:186@C1' idatm_type C3 atom id /R:186@N1 idatm_type Npl atom id /R:186@C2 idatm_type C2 atom id /R:186@O2 idatm_type O2 atom id /R:186@N3 idatm_type N2 atom id /R:186@C4 idatm_type C2 atom id /R:186@N4 idatm_type Npl atom id /R:186@C5 idatm_type C2 atom id /R:186@C6 idatm_type C2 atom id /R:187@P idatm_type Pac atom id /R:187@OP1 idatm_type O3- atom id /R:187@OP2 idatm_type O3- atom id /R:187@O5' idatm_type O3 atom id /R:187@C5' idatm_type C3 atom id /R:187@C4' idatm_type C3 atom id /R:187@O4' idatm_type O3 atom id /R:187@C3' idatm_type C3 atom id /R:187@O3' idatm_type O3 atom id /R:187@C2' idatm_type C3 atom id /R:187@O2' idatm_type O3 atom id /R:187@C1' idatm_type C3 atom id /R:187@N1 idatm_type Npl atom id /R:187@C2 idatm_type C2 atom id /R:187@O2 idatm_type O2 atom id /R:187@N3 idatm_type Npl atom id /R:187@C4 idatm_type C2 atom id /R:187@O4 idatm_type O2 atom id /R:187@C5 idatm_type C2 atom id /R:187@C6 idatm_type C2 atom id /R:188@P idatm_type Pac atom id /R:188@OP1 idatm_type O3- atom id /R:188@OP2 idatm_type O3- atom id /R:188@O5' idatm_type O3 atom id /R:188@C5' idatm_type C3 atom id /R:188@C4' idatm_type C3 atom id /R:188@O4' idatm_type O3 atom id /R:188@C3' idatm_type C3 atom id /R:188@O3' idatm_type O3 atom id /R:188@C2' idatm_type C3 atom id /R:188@O2' idatm_type O3 atom id /R:188@C1' idatm_type C3 atom id /R:188@N9 idatm_type Npl atom id /R:188@C8 idatm_type Car atom id /R:188@N7 idatm_type N2 atom id /R:188@C5 idatm_type Car atom id /R:188@C6 idatm_type C2 atom id /R:188@O6 idatm_type O2 atom id /R:188@N1 idatm_type Npl atom id /R:188@C2 idatm_type C2 atom id /R:188@N2 idatm_type Npl atom id /R:188@N3 idatm_type N2 atom id /R:188@C4 idatm_type Car atom id /R:189@P idatm_type Pac atom id /R:189@OP1 idatm_type O3- atom id /R:189@OP2 idatm_type O3- atom id /R:189@O5' idatm_type O3 atom id /R:189@C5' idatm_type C3 atom id /R:189@C4' idatm_type C3 atom id /R:189@O4' idatm_type O3 atom id /R:189@C3' idatm_type C3 atom id /R:189@O3' idatm_type O3 atom id /R:189@C2' idatm_type C3 atom id /R:189@O2' idatm_type O3 atom id /R:189@C1' idatm_type C3 atom id /R:189@N9 idatm_type Npl atom id /R:189@C8 idatm_type Car atom id /R:189@N7 idatm_type N2 atom id /R:189@C5 idatm_type Car atom id /R:189@C6 idatm_type C2 atom id /R:189@O6 idatm_type O2 atom id /R:189@N1 idatm_type Npl atom id /R:189@C2 idatm_type C2 atom id /R:189@N2 idatm_type Npl atom id /R:189@N3 idatm_type N2 atom id /R:189@C4 idatm_type Car atom id /R:190@P idatm_type Pac atom id /R:190@OP1 idatm_type O3- atom id /R:190@OP2 idatm_type O3- atom id /R:190@O5' idatm_type O3 atom id /R:190@C5' idatm_type C3 atom id /R:190@C4' idatm_type C3 atom id /R:190@O4' idatm_type O3 atom id /R:190@C3' idatm_type C3 atom id /R:190@O3' idatm_type O3 atom id /R:190@C2' idatm_type C3 atom id /R:190@O2' idatm_type O3 atom id /R:190@C1' idatm_type C3 atom id /R:190@N1 idatm_type Npl atom id /R:190@C2 idatm_type C2 atom id /R:190@O2 idatm_type O2 atom id /R:190@N3 idatm_type N2 atom id /R:190@C4 idatm_type C2 atom id /R:190@N4 idatm_type Npl atom id /R:190@C5 idatm_type C2 atom id /R:190@C6 idatm_type C2 atom id /R:191@P idatm_type Pac atom id /R:191@OP1 idatm_type O3- atom id /R:191@OP2 idatm_type O3- atom id /R:191@O5' idatm_type O3 atom id /R:191@C5' idatm_type C3 atom id /R:191@C4' idatm_type C3 atom id /R:191@O4' idatm_type O3 atom id /R:191@C3' idatm_type C3 atom id /R:191@O3' idatm_type O3 atom id /R:191@C2' idatm_type C3 atom id /R:191@O2' idatm_type O3 atom id /R:191@C1' idatm_type C3 atom id /R:191@N1 idatm_type Npl atom id /R:191@C2 idatm_type C2 atom id /R:191@O2 idatm_type O2 atom id /R:191@N3 idatm_type N2 atom id /R:191@C4 idatm_type C2 atom id /R:191@N4 idatm_type Npl atom id /R:191@C5 idatm_type C2 atom id /R:191@C6 idatm_type C2 atom id /R:192@P idatm_type Pac atom id /R:192@OP1 idatm_type O3- atom id /R:192@OP2 idatm_type O3- atom id /R:192@O5' idatm_type O3 atom id /R:192@C5' idatm_type C3 atom id /R:192@C4' idatm_type C3 atom id /R:192@O4' idatm_type O3 atom id /R:192@C3' idatm_type C3 atom id /R:192@O3' idatm_type O3 atom id /R:192@C2' idatm_type C3 atom id /R:192@O2' idatm_type O3 atom id /R:192@C1' idatm_type C3 atom id /R:192@N1 idatm_type Npl atom id /R:192@C2 idatm_type C2 atom id /R:192@O2 idatm_type O2 atom id /R:192@N3 idatm_type N2 atom id /R:192@C4 idatm_type C2 atom id /R:192@N4 idatm_type Npl atom id /R:192@C5 idatm_type C2 atom id /R:192@C6 idatm_type C2 > info traptr 1 models #1, 7v99, shown 14582 atoms, 15404 bonds, 1419 residues, 5 chains (A,K,L,R,S) 193 hydrogen bonds, 3 missing structure > info beforetraptr1 1 models #1, 7v99, shown 14582 atoms, 15404 bonds, 1419 residues, 5 chains (A,K,L,R,S) 193 hydrogen bonds, 3 missing structure > info matt Expected a models specifier or a keyword > color beforetraptr1 green > color beforetraptr2 red > name list before_traptr sel beforetr1 sel beforetraptr1 sel beforetraptr2 sel test1 sel trapping_TR sel traptr sel > select protein 9299 atoms, 9512 bonds, 1 pseudobond, 1170 residues, 2 models selected > color test1 red > color traptr blue > name delete all > name list There are no user-defined specifier names. > name traptr select /r:237-334 ""select /r:237-334"": invalid atom specifier > name traptr selection /r:237-334 ""selection /r:237-334"": invalid atom specifier > name traptr /r:237-334 > name before_traptr1 /r:33-147 > name before_traptr2 /r:163-192 > name before_traptr /r:33-192 > color /a blue > color /a lightblue > color /j green > color /k green > color /k lightgreen > color /l lightred Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero', 'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms', 'fromcartoons', 'fromribbons', or 'random' or a keyword > color /l lightred Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero', 'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms', 'fromcartoons', 'fromribbons', or 'random' or a keyword > color /l green > lighting soft > color before_traptr pink > save ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" ——— End of log from Thu Jun 8 16:55:49 2023 ——— opened ChimeraX session UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. How to cite UCSF ChimeraX > color before_traptr red > color before_traptr pink > lighting simple > lighting soft > lighting full > lighting soft > transparency /a 50 > transparency /a 40 > transparency /a 20 > transparency /a 10 > transparency /a 90 > transparency /a 0 > transparency /a 5 > hide /a atoms > hide /a surfaces > show /a surfaces > selection /a Unknown command: selection /a > select /a 7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected > color sel byhetero > color sel bychain > color sel bypolymer > rainbow sel > color sel bychain > hide sel atoms > hide sel cartoons > hide sel surfaces > show sel surfaces > surface style #1.3 mesh > surface style #1.3 dot > surface style #1.3 solid > transparency (#!1 & sel) 100 > transparency (#!1 & sel) 90 > transparency (#!1 & sel) 70 > save ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" > ui tool show ""Surface Color"" > ui tool show ""File History"" > ui tool show AlphaFold > alphafold match #1/A Fetching AlphaFold database settings from https://www.rbvi.ucsf.edu/chimerax/data/status/alphafold_database3.json Fetching compressed AlphaFold O14746 from https://alphafold.ebi.ac.uk/files/AF-O14746-F1-model_v4.cif 1 AlphaFold model found using UniProt identifier: O14746 (chain A) AlphaFold prediction matching 7v99 --- Chain| UniProt Id| UniProt Name| RMSD| Length| Seen| % Id A | O14746 | TERT_HUMAN | 5.03 | 1132 | 991 | 100 Opened 1 AlphaFold model > hide #!2 models > show #!2 models > hide #!2 models > hide target m > show target m > hide #!2 models > close #2 > roll > roll stop Expected an axis vector or a keyword > roll off Expected an axis vector or a keyword > stop > tile 2 Expected a models specifier or a keyword > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected Unsupported scale factor (0.000000) detected on Display0 > select /R 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > select /R 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > hide beforetraptr Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > name list before_traptr /r:33-192 before_traptr1 /r:33-147 before_traptr2 /r:163-192 beforetr1 sel beforetraptr1 sel test1 sel trapping_TR sel traptr /r:237-334 > hide before_traptr > hide before_traptr atoms, ribbons > hide /a > hide /a surfaces > hide /s atoms, ribbons > name long_loop_hp selection /r:276-2279 ""selection /r:276-2279"": invalid atom specifier > name long_loop_hp selection /r:276-279 ""selection /r:276-279"": invalid atom specifier > name long_loop_hp select /r:276-279 ""select /r:276-279"": invalid atom specifier > name long_loop_hp /r:276-279 > color long_loop_hp red > save ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" > save /Users/matthewcomstock/Desktop/image1.png supersample 3 QPainter::begin: Paint device returned engine == 0, type: 3 ===== Log before crash end ===== Log: UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. > open ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" Log from Mon Jun 12 09:55:11 2023UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. > open ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" Log from Thu Jun 8 16:55:49 2023UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. > open ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" Log from Tue Jun 6 16:44:25 2023UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. How to cite UCSF ChimeraX > help help:quickstart > open 2bbv 2bbv title: The refined three-dimensional structure of an insect virus At 2.8 angstroms resolution [more info...] Chain information for 2bbv #1 --- Chain | Description | UniProt A B C | PROTEIN (BLACK BEETLE VIRUS CAPSID PROTEIN) | COAT_BBV 1-363 D E F | PROTEIN (BLACK BEETLE VIRUS CAPSID PROTEIN) | COAT_BBV 364-407 N | RNA (5'-R(*UP*CP*UP*UP*AP*UP*AP*UP*CP*U)-3') | Non-standard residues in 2bbv #1 --- CA — calcium ion 2bbv mmCIF Assemblies --- 1| complete icosahedral assembly 2| icosahedral asymmetric unit 3| icosahedral pentamer 4| icosahedral 23 hexamer 5| icosahedral asymmetric unit, std point frame 6| crystal asymmetric unit, crystal frame > color bychain > style /b stick Changed 2382 atom styles > color /n teal [Repeated 1 time(s)] > hide /c > show /c > hide /n > shown /n Unknown command: shown /n > show /n [Repeated 1 time(s)] > ribbon /c [Repeated 1 time(s)] > ribbon /n > style /n ribbon Expected a keyword > select /N:4@C5' 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select down 201 atoms, 222 bonds, 10 residues, 1 model selected > select down 20 atoms, 21 bonds, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select down 201 atoms, 222 bonds, 10 residues, 1 model selected > select down 20 atoms, 21 bonds, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select down 201 atoms, 222 bonds, 10 residues, 1 model selected > select down 20 atoms, 21 bonds, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select up 7817 atoms, 7813 bonds, 1208 residues, 1 model selected > select down 201 atoms, 222 bonds, 10 residues, 1 model selected > select down 20 atoms, 21 bonds, 1 residue, 1 model selected > select down 1 atom, 1 residue, 1 model selected > select up 20 atoms, 21 bonds, 1 residue, 1 model selected > select up 201 atoms, 222 bonds, 10 residues, 1 model selected > color sel gold > select clear > color sel gold > select clear > color sel gold > select clear > color sel gold > select clear > color sel red > surface #1 > color /n fromatoms > surface #1 > surface #2 No atoms specified by #2 > surface > surface #1 hide Expected a keyword > hide surfaces #1 Expected ',' or a keyword > hide surfaces > show surfaces > hide surfaces > style solvent sphere Changed 208 atom styles > color solvent red > sym #1 2bbv mmCIF Assemblies --- 1| complete icosahedral assembly| 60 copies of chains A-F,N 2| icosahedral asymmetric unit| 1 copy of chains A-F,N 3| icosahedral pentamer| 5 copies of chains A-F,N 4| icosahedral 23 hexamer| 6 copies of chains A-F,N 5| icosahedral asymmetric unit, std point frame| 1 copy of chains A-F,N 6| crystal asymmetric unit, crystal frame| 5 copies of chains A-F,N > hide #1 models > show #1 > show #1 models > sym #1 assembly 3 newModel false copies false Made 5 graphical clones for 2bbv assembly 3 > sym #1 assembly 1 Made 60 graphical clones for 2bbv assembly 1 > show #!1 models > hide #!1 models > show #!1 models > hide #!1 models > hide #!2 models > show #!2 models > sym #1 assembly 1view Assembly ""1view"" not found, have 1, 2, 3, 4, 5, 6 > view > set bgColor white > set silhouettes true > save /Users/matthewcomstock/Desktop/2bbv.png > movie record > turn y 2 180 > wait 180 > movie encode /Users/matthewcomstock/Desktop/movie1.mp4 Movie saved to /Users/matthewcomstock/Desktop/movie1.mp4 > close #2 > sym #1 assembly 3 newModel false copies false Made 5 graphical clones for 2bbv assembly 3 > show #1 models > view > ui mousemode right zoom > ui mousemode right translate > ui mousemode right zoom > surface #1 > color /n fromatoms > style solvent sphere Changed 208 atom styles > color solvent red > view > close > set bgColor black > set bgColor transparent > set silhouettes false > open 1080 fromDatabase emdb Summary of feedback from opening 1080 fetched from emdb --- note | Fetching compressed map 1080 from ftp://ftp.ebi.ac.uk/pub/databases/emdb/structures/EMD-1080/map/emd_1080.map.gz Opened emdb 1080 as #1, grid size 100,100,100, pixel 2.7, shown at level 1.68, step 1, values float32 > lighting full > volume #1 level 0.9 > volume #1 level .5 > volume #1 level .2 > volume #1 level .1 > volume #1 level 2 > volume #1 level .15 > volume #1 level 1.68 > ui mousemode right ""contour level"" > volume #1 level 1.812 > volume #1 level 1.773 > volume #1 level 1.504 > volume #1 level 1.275 > volume #1 encloseVolume 1e6 step 1 color tan > volume #1 1e5 step 1 Expected a keyword > volume #1 1e5 step 1 color tan Expected a keyword > volume #1 encloseVolume 1e5 step 1 > volume #1 encloseVolume 1e4 step 1 > volume #1 encloseVolume 1e6 step 1 color tan > set bgColor gray > set bgColor #80808000 > set silhouettes true > open 1grl Summary of feedback from opening 1grl fetched from pdb --- note | Fetching compressed mmCIF 1grl from http://files.rcsb.org/download/1grl.cif 1grl title: The crystal structure of the bacterial chaperonin groel At 2.8 angstroms [more info...] Chain information for 1grl #2 --- Chain | Description | UniProt A B C D E F G | GROEL (HSP60 CLASS) | CH60_ECOLI 2-548 1grl mmCIF Assemblies --- 1| author_and_software_defined_assembly 2| software_defined_assembly > lighting default > ui mousemode right zoom > ui mousemode right ""translate selected models"" > select /D:357@CG2 1 atom, 1 residue, 1 model selected > view matrix models #2,1,0,0,44.01,0,1,0,-1.4223,0,0,1,-0.37848 > ui mousemode right ""rotate selected models"" > view matrix models > #2,0.99999,-0.0041909,0.002923,44.116,0.0043018,0.99923,-0.039047,-2.5771,-0.0027571,0.039059,0.99923,-0.57913 > view matrix models > #2,0.99572,-0.092469,0.00020636,43.966,0.092405,0.99494,-0.039468,1.1951,0.0034442,0.039318,0.99922,-0.31382 > fitmap #2 inMap #1 Fit molecule 1grl (#2) to map emdb 1080 (#1) using 29274 atoms average map value = 1.33, steps = 104 shifted from previous position = 0.914 rotated from previous position = 20.7 degrees atoms outside contour = 3707, contour level = 0.82501 Position of 1grl (#2) relative to emdb 1080 (#1) coordinates: Matrix rotation and translation 0.90168809 -0.43225449 -0.01070721 39.38415285 0.43238288 0.90129381 0.02673023 18.93264110 -0.00190392 -0.02873195 0.99958534 -0.07033036 Axis -0.06401015 -0.01016007 0.99789753 Axis point -21.87968789 95.67746379 0.00000000 Rotation angle (degrees) 25.67269007 Shift along axis -2.78352503 > volume #1 transparency 0.5 > view matrix models > #2,0.92048,-0.39074,-0.0062701,40.283,0.39076,0.92009,0.027407,17.143,-0.0049401,-0.027678,0.9996,-0.20146 > fitmap #2 inMap #1 Fit molecule 1grl (#2) to map emdb 1080 (#1) using 29274 atoms average map value = 1.33, steps = 60 shifted from previous position = 0.0354 rotated from previous position = 2.63 degrees atoms outside contour = 3704, contour level = 0.82501 Position of 1grl (#2) relative to emdb 1080 (#1) coordinates: Matrix rotation and translation 0.90160406 -0.43242969 -0.01070914 39.38027615 0.43255808 0.90120994 0.02672371 18.93993563 -0.00190494 -0.02872653 0.99958549 -0.07718132 Axis -0.06397061 -0.01015704 0.99790009 Axis point -21.87911091 95.63336281 0.00000000 Rotation angle (degrees) 25.68378070 Shift along axis -2.78857344 > volume #1 transparency 0.5 > molmap #2 10 Opened 1grl map 10 as #3, grid size 63,63,41, pixel 3.33, shown at level 0.0611, step 1, values float32 > volume #3 style mesh > volume subtract #1 #3 minRms true Opened volume difference as #4, grid size 100,100,100, pixel 2.7, shown at step 1, values float32 Minimum RMS scale factor for ""1grl map 10 #3"" above level 0.061077 is 4.5565 > volume #4 color pink transparency 0 > hide atoms > show ribbons > close > set bgColor black > set bgColor transparent > set silhouettes false > open 1a0m fromDatabase eds Summary of feedback from opening 1a0m fetched from eds --- note | Fetching map 1a0m from http://www.ebi.ac.uk/pdbe/coordinates/files/1a0m.ccp4 Opened eds 1a0m as #1, grid size 97,101,88, pixel 0.37,0.37,0.367, shown at level 2.28, step 1, values float32 > open 1a0m Summary of feedback from opening 1a0m fetched from pdb --- note | Fetching compressed mmCIF 1a0m from http://files.rcsb.org/download/1a0m.cif 1a0m title: 1.1 angstrom crystal structure of A-conotoxin [TYR15]-epi [more info...] Chain information for 1a0m #2 --- Chain | Description | UniProt A B | ALPHA-CONOTOXIN [TYR15]-EPI | CXA1_CONEP 1-16 Non-standard residues in 1a0m #2 --- NH2 — amino group > hide ribbons > show > volume #1 level 1.0 style mesh > ui mousemode right zoom > volume zone #1 nearAtoms #2 range 2 > volume #1 level 0.5 transparency 0.6 > close > open 1273 fromDatabase emdb Summary of feedback from opening 1273 fetched from emdb --- note | Fetching compressed map 1273 from ftp://ftp.ebi.ac.uk/pub/databases/emdb/structures/EMD-1273/map/emd_1273.map.gz Opened emdb 1273 as #1, grid size 2048,2048,76, pixel 22.5, shown at step 1, values int8 > volume #1 region all showOutlineBox true > close > open 7v99 Summary of feedback from opening 7v99 fetched from pdb --- note | Fetching compressed mmCIF 7v99 from http://files.rcsb.org/download/7v99.cif 7v99 title: catalytic core of human telomerase holoenzyme [more info...] Chain information for 7v99 #1 --- Chain | Description | UniProt A | Telomerase reverse transcriptase | TERT_HUMAN 1-1132 K | Histone H2A type 1-B/E | H2A1B_HUMAN 1-129 L | Histone H2B type 1-K | H2B1K_HUMAN 1-125 R | Telomerase RNA component | S | Primer DNA | > color bychain > set bgColor white > set bgColor #ffffff00 > lighting simple > lighting full > hide atoms > show cartoons > show atoms > show surfaces > nucleotides ladder > graphics silhouettes true > volume hide No volumes specified > select /R:33-334 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > hide surfaces sel Expected ',' or a keyword > hide sel surfaces > color sel orange > hide /a > hide /a atoms > hide /a surfaces > hide /a ribbons > hide /s > hide /s all Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > hide /s models [Repeated 1 time(s)] > show /s models > show /s atoms > hide /s atoms > hide /s surfaces > hide /s ribbons > sym #1 7v99 mmCIF Assemblies --- 1| author_defined_assembly| 1 copy of chains A,K,L,R,S > show /a surfaces > color /r teal > color /r orange > color /k green > color /l green > color /k red > hide sel atoms > show sel atoms > color sel bynucleotide > nucleotides sel stubs > nucleotides sel ladder > nucleotides sel stubs > nucleotides sel tube/slab shape muffler > nucleotides sel tube/slab shape ellipsoid > nucleotides sel tube/slab shape box > nucleotides sel slab > style nucleic & sel stick Changed 5156 atom styles > nucleotides sel fill > style nucleic & sel stick Changed 5156 atom styles > nucleotides sel stubs > nucleotides sel ladder > color #1.4 #ff59f5ff > hide /k atoms > hide /l atoms > color #1.5 #00d301ff > color #1.5 #00da01ff > save ""/Users/matthewcomstock/OneDrive - Michigan State University/project > analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera > work.cxs"" > open https://www.rbvi.ucsf.edu/chimerax/tutorials.html Opened https://www.rbvi.ucsf.edu/chimerax/tutorials.html > ui tool show ""Show Sequence Viewer"" > sequence chain /R Alignment identifier is 1/R > select sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > color sel red > color sel orange > save ""/Users/matthewcomstock/OneDrive - Michigan State University/project > analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera > work.cxs"" > ui tool show ""Show Sequence Viewer"" > sequence chain /R Destroying pre-existing alignment with identifier 1/R Alignment identifier is 1/R > select /a 7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected > select /r 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > select /r sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > select sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > select /r 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > select /r :1:10 Nothing selected > select /r:1:10 Nothing selected > select /r:10 Nothing selected > select /r:100 20 atoms, 21 bonds, 1 residue, 1 model selected > select /r:101 20 atoms, 21 bonds, 1 residue, 1 model selected > select /r:237 20 atoms, 21 bonds, 1 residue, 1 model selected > color sel red > color sel green > color /r:334 red > save /Users/matthewcomstock/Desktop/image1.png supersample 3 > hide /r:start-236 > hide ribbons /r:start-236 Expected ',' or a keyword > hide /r:start-236 ribbons > hide /r:335-end atoms, ribbons > show /r:335-end atoms, ribbons > show /r:335-end atoms > show /r:335-end > hide /r:335-end > show /r atoms, ribbons > hide /r atoms, ribbons > show /r atoms, ribbons > hide sequence ggguug atoms, ribbon Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > select /r sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > name trapping_TR sel > name traptr sel > color traptr red > color traptr orange > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > name before_traptr sel > hide before_traptr atoms, ribbons > save /Users/matthewcomstock/Desktop/image1.png supersample 3 > movie record > turn y 2 180 > wait 180 > movie encode /Users/matthewcomstock/Desktop/movie1.mp4 Movie saved to /Users/matthewcomstock/Desktop/movie1.mp4 > save ""/Users/matthewcomstock/OneDrive - Michigan State University/project > analysis/230308 telomerase RNA structure/telomerase structures/7v99 chimera > work.cxs"" > cd ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures"" Current working directory is: /Users/matthewcomstock/Library/CloudStorage/OneDrive- MichiganStateUniversity/project analysis/230308 telomerase RNA structure/telomerase structures > select /a 7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected > transparency (#!1 & sel) 50 > show /s atoms, ribbons > color /s red > show before_traptr ribbons > hide before_traptr ribbons > ribbon before_traptr > hide ribbons > show ribbons > hide /a ribbons > hide before_traptr > hide before_traptr ribbons > before_traptr Unknown command: before_traptr > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > hide sel > hide sel ribbons > hide sel ribbons, atoms > show sel ribbons, atoms > hide sel ribbons, atoms > name before_traptr sel > show before_traptr ribbons > show before_traptr ribbons, atoms > hide before_traptr ribbons, atoms > show before_traptr ribbons > show before_traptr ribbons transparency .5 Expected ',' or a keyword > show before_traptr ribbon, transparency .5 Missing or invalid ""what"" argument: Should be one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' > transparancy before_traptr 0.5 Unknown command: transparancy before_traptr 0.5 > select before_traptr 5156 atoms, 3422 bonds, 104 pseudobonds, 243 residues, 3 models selected > transparancy 0.5 Unknown command: transparancy 0.5 > transparency 0.5 > transparency 1 > transparency /a 50 > transparency /a 75 > transparency /a 25 > transparency /a 35 > transparency before_traptr 35 > surface before_traptr > hide surfaces > show /a surfaces > show /k, /l surface Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > show /k or /l surface Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > show /k and /l surface Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > show /l surfaces > show /k surfaces > hide before_traptr > hide traptr > hide traptr ribbons > hide traptr ribbons, atoms > show traptr ribbons, atoms > /r > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg Unknown command: sequence /r ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg > select sequence /r > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg Expected a keyword > select /r sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > name traptr /r sequence > ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg ""/r sequence ccgaaccccgccuggaggccgcggucggcccggggcuucuccggaggcacccacugccaccgcgaagaguugggcucugucagccgcgggucucucgg"": contains extra trailing text > name traptr sel > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > name before_traptr sel > hide before_traptr > hide before_traptr atoms, ribbons > hide traptr atoms, ribbons > lighting soft > lighting simple > lighting full > lighting simple > show /r:33:147 > show /r:33-147 > show /r:33-137 > show /r:33-147 > hide /r:33-147 > select /r:237-334 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > name traptr sel > hide traptr > hide traptr atoms, ribbons > show traptr atoms, ribbons > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected > select /r:163-192 643 atoms, 720 bonds, 30 residues, 1 model selected > name beforetr1 sel > show beforetr1 atoms, ribbons > hide beforetr1 atoms, ribbons > hide traptr atoms, ribbons [Repeated 1 time(s)] > hide traptr > select /r:237-334 2087 atoms, 2328 bonds, 81 pseudobonds, 98 residues, 2 models selected > select /r:33-147 2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected > show /r:33-147 > hide /r:33-147 > select /r:33-147 2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected > name test1 sel > show test1 > hide test1 > select test1 5156 atoms, 2702 bonds, 59 pseudobonds, 243 residues, 2 models selected > select /r:33-147 2426 atoms, 2702 bonds, 59 pseudobonds, 115 residues, 2 models selected > name beforetraptr1 ""beforetraptr1"" is not defined > name beforetraptr1 sel > show beforetraptr1 > hide beforetraptr1 > show beforetraptr1 atoms, ribbons > hide beforetraptr1 atoms, ribbons > show beforetraptr1 atoms, ribbons > show beforetraptr1 atoms, ribbons, surfaces > hide beforetraptr1 atoms, ribbons > color beforetraptr1 teal > hide beforetraptr1 surfaces > show beforetraptr1 atoms, ribbons > transparency beforetraptr1 50 target all > transparency beforetraptr1 50 target All Invalid ""target"" argument: Character 'A' is not an allowed target, must be one of acrsbmpfl > transparency beforetraptr1 50 target all > transparency beforetraptr1 10 target all > transparency beforetraptr1 100 target all > color beforetraptr1 red > color beforetraptr1 pink > select /r:163-192 643 atoms, 720 bonds, 30 residues, 1 model selected > select /r:163-192 643 atoms, 720 bonds, 30 residues, 1 model selected > name beforetraptr2 sel > show beforetraptr2 atoms, ribbons > color beforetraptr2 pink > save ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" ——— End of log from Tue Jun 6 16:44:25 2023 ——— opened ChimeraX session UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. How to cite UCSF ChimeraX > show traptr ribbons, atoms > hide traptr ribbons, atoms > show traptr ribbons, atoms > color traptr red > info chains chain id /A chain_id A chain id /K chain_id K chain id /L chain_id L chain id /R chain_id R chain id /S chain_id S > info models model id #1 type AtomicStructure name 7v99 model id #1.1 type PseudobondGroup name ""hydrogen bonds"" model id #1.2 type PseudobondGroup name ""missing structure"" model id #1.3 type MolecularSurface name ""7v99_A SES surface"" model id #1.4 type MolecularSurface name ""7v99_K SES surface"" model id #1.5 type MolecularSurface name ""7v99_L SES surface"" model id #1.6 type MolecularSurface name ""7v99_R SES surface"" model id #1.7 type MolecularSurface name ""7v99_S SES surface"" > info selection atom id /R:163@P idatm_type Pac atom id /R:163@OP1 idatm_type O3- atom id /R:163@OP2 idatm_type O3- atom id /R:163@O5' idatm_type O3 atom id /R:163@C5' idatm_type C3 atom id /R:163@C4' idatm_type C3 atom id /R:163@O4' idatm_type O3 atom id /R:163@C3' idatm_type C3 atom id /R:163@O3' idatm_type O3 atom id /R:163@C2' idatm_type C3 atom id /R:163@O2' idatm_type O3 atom id /R:163@C1' idatm_type C3 atom id /R:163@N9 idatm_type Npl atom id /R:163@C8 idatm_type Car atom id /R:163@N7 idatm_type N2 atom id /R:163@C5 idatm_type Car atom id /R:163@C6 idatm_type C2 atom id /R:163@O6 idatm_type O2 atom id /R:163@N1 idatm_type Npl atom id /R:163@C2 idatm_type C2 atom id /R:163@N2 idatm_type Npl atom id /R:163@N3 idatm_type N2 atom id /R:163@C4 idatm_type Car atom id /R:164@P idatm_type Pac atom id /R:164@OP1 idatm_type O3- atom id /R:164@OP2 idatm_type O3- atom id /R:164@O5' idatm_type O3 atom id /R:164@C5' idatm_type C3 atom id /R:164@C4' idatm_type C3 atom id /R:164@O4' idatm_type O3 atom id /R:164@C3' idatm_type C3 atom id /R:164@O3' idatm_type O3 atom id /R:164@C2' idatm_type C3 atom id /R:164@O2' idatm_type O3 atom id /R:164@C1' idatm_type C3 atom id /R:164@N9 idatm_type Npl atom id /R:164@C8 idatm_type Car atom id /R:164@N7 idatm_type N2 atom id /R:164@C5 idatm_type Car atom id /R:164@C6 idatm_type Car atom id /R:164@N6 idatm_type Npl atom id /R:164@N1 idatm_type N2 atom id /R:164@C2 idatm_type Car atom id /R:164@N3 idatm_type N2 atom id /R:164@C4 idatm_type Car atom id /R:165@P idatm_type Pac atom id /R:165@OP1 idatm_type O3- atom id /R:165@OP2 idatm_type O3- atom id /R:165@O5' idatm_type O3 atom id /R:165@C5' idatm_type C3 atom id /R:165@C4' idatm_type C3 atom id /R:165@O4' idatm_type O3 atom id /R:165@C3' idatm_type C3 atom id /R:165@O3' idatm_type O3 atom id /R:165@C2' idatm_type C3 atom id /R:165@O2' idatm_type O3 atom id /R:165@C1' idatm_type C3 atom id /R:165@N9 idatm_type Npl atom id /R:165@C8 idatm_type Car atom id /R:165@N7 idatm_type N2 atom id /R:165@C5 idatm_type Car atom id /R:165@C6 idatm_type C2 atom id /R:165@O6 idatm_type O2 atom id /R:165@N1 idatm_type Npl atom id /R:165@C2 idatm_type C2 atom id /R:165@N2 idatm_type Npl atom id /R:165@N3 idatm_type N2 atom id /R:165@C4 idatm_type Car atom id /R:166@P idatm_type Pac atom id /R:166@OP1 idatm_type O3- atom id /R:166@OP2 idatm_type O3- atom id /R:166@O5' idatm_type O3 atom id /R:166@C5' idatm_type C3 atom id /R:166@C4' idatm_type C3 atom id /R:166@O4' idatm_type O3 atom id /R:166@C3' idatm_type C3 atom id /R:166@O3' idatm_type O3 atom id /R:166@C2' idatm_type C3 atom id /R:166@O2' idatm_type O3 atom id /R:166@C1' idatm_type C3 atom id /R:166@N1 idatm_type Npl atom id /R:166@C2 idatm_type C2 atom id /R:166@O2 idatm_type O2 atom id /R:166@N3 idatm_type N2 atom id /R:166@C4 idatm_type C2 atom id /R:166@N4 idatm_type Npl atom id /R:166@C5 idatm_type C2 atom id /R:166@C6 idatm_type C2 atom id /R:167@P idatm_type Pac atom id /R:167@OP1 idatm_type O3- atom id /R:167@OP2 idatm_type O3- atom id /R:167@O5' idatm_type O3 atom id /R:167@C5' idatm_type C3 atom id /R:167@C4' idatm_type C3 atom id /R:167@O4' idatm_type O3 atom id /R:167@C3' idatm_type C3 atom id /R:167@O3' idatm_type O3 atom id /R:167@C2' idatm_type C3 atom id /R:167@O2' idatm_type O3 atom id /R:167@C1' idatm_type C3 atom id /R:167@N9 idatm_type Npl atom id /R:167@C8 idatm_type Car atom id /R:167@N7 idatm_type N2 atom id /R:167@C5 idatm_type Car atom id /R:167@C6 idatm_type Car atom id /R:167@N6 idatm_type Npl atom id /R:167@N1 idatm_type N2 atom id /R:167@C2 idatm_type Car atom id /R:167@N3 idatm_type N2 atom id /R:167@C4 idatm_type Car atom id /R:168@P idatm_type Pac atom id /R:168@OP1 idatm_type O3- atom id /R:168@OP2 idatm_type O3- atom id /R:168@O5' idatm_type O3 atom id /R:168@C5' idatm_type C3 atom id /R:168@C4' idatm_type C3 atom id /R:168@O4' idatm_type O3 atom id /R:168@C3' idatm_type C3 atom id /R:168@O3' idatm_type O3 atom id /R:168@C2' idatm_type C3 atom id /R:168@O2' idatm_type O3 atom id /R:168@C1' idatm_type C3 atom id /R:168@N9 idatm_type Npl atom id /R:168@C8 idatm_type Car atom id /R:168@N7 idatm_type N2 atom id /R:168@C5 idatm_type Car atom id /R:168@C6 idatm_type Car atom id /R:168@N6 idatm_type Npl atom id /R:168@N1 idatm_type N2 atom id /R:168@C2 idatm_type Car atom id /R:168@N3 idatm_type N2 atom id /R:168@C4 idatm_type Car atom id /R:169@P idatm_type Pac atom id /R:169@OP1 idatm_type O3- atom id /R:169@OP2 idatm_type O3- atom id /R:169@O5' idatm_type O3 atom id /R:169@C5' idatm_type C3 atom id /R:169@C4' idatm_type C3 atom id /R:169@O4' idatm_type O3 atom id /R:169@C3' idatm_type C3 atom id /R:169@O3' idatm_type O3 atom id /R:169@C2' idatm_type C3 atom id /R:169@O2' idatm_type O3 atom id /R:169@C1' idatm_type C3 atom id /R:169@N9 idatm_type Npl atom id /R:169@C8 idatm_type Car atom id /R:169@N7 idatm_type N2 atom id /R:169@C5 idatm_type Car atom id /R:169@C6 idatm_type Car atom id /R:169@N6 idatm_type Npl atom id /R:169@N1 idatm_type N2 atom id /R:169@C2 idatm_type Car atom id /R:169@N3 idatm_type N2 atom id /R:169@C4 idatm_type Car atom id /R:170@P idatm_type Pac atom id /R:170@OP1 idatm_type O3- atom id /R:170@OP2 idatm_type O3- atom id /R:170@O5' idatm_type O3 atom id /R:170@C5' idatm_type C3 atom id /R:170@C4' idatm_type C3 atom id /R:170@O4' idatm_type O3 atom id /R:170@C3' idatm_type C3 atom id /R:170@O3' idatm_type O3 atom id /R:170@C2' idatm_type C3 atom id /R:170@O2' idatm_type O3 atom id /R:170@C1' idatm_type C3 atom id /R:170@N1 idatm_type Npl atom id /R:170@C2 idatm_type C2 atom id /R:170@O2 idatm_type O2 atom id /R:170@N3 idatm_type N2 atom id /R:170@C4 idatm_type C2 atom id /R:170@N4 idatm_type Npl atom id /R:170@C5 idatm_type C2 atom id /R:170@C6 idatm_type C2 atom id /R:171@P idatm_type Pac atom id /R:171@OP1 idatm_type O3- atom id /R:171@OP2 idatm_type O3- atom id /R:171@O5' idatm_type O3 atom id /R:171@C5' idatm_type C3 atom id /R:171@C4' idatm_type C3 atom id /R:171@O4' idatm_type O3 atom id /R:171@C3' idatm_type C3 atom id /R:171@O3' idatm_type O3 atom id /R:171@C2' idatm_type C3 atom id /R:171@O2' idatm_type O3 atom id /R:171@C1' idatm_type C3 atom id /R:171@N9 idatm_type Npl atom id /R:171@C8 idatm_type Car atom id /R:171@N7 idatm_type N2 atom id /R:171@C5 idatm_type Car atom id /R:171@C6 idatm_type Car atom id /R:171@N6 idatm_type Npl atom id /R:171@N1 idatm_type N2 atom id /R:171@C2 idatm_type Car atom id /R:171@N3 idatm_type N2 atom id /R:171@C4 idatm_type Car atom id /R:172@P idatm_type Pac atom id /R:172@OP1 idatm_type O3- atom id /R:172@OP2 idatm_type O3- atom id /R:172@O5' idatm_type O3 atom id /R:172@C5' idatm_type C3 atom id /R:172@C4' idatm_type C3 atom id /R:172@O4' idatm_type O3 atom id /R:172@C3' idatm_type C3 atom id /R:172@O3' idatm_type O3 atom id /R:172@C2' idatm_type C3 atom id /R:172@O2' idatm_type O3 atom id /R:172@C1' idatm_type C3 atom id /R:172@N9 idatm_type Npl atom id /R:172@C8 idatm_type Car atom id /R:172@N7 idatm_type N2 atom id /R:172@C5 idatm_type Car atom id /R:172@C6 idatm_type Car atom id /R:172@N6 idatm_type Npl atom id /R:172@N1 idatm_type N2 atom id /R:172@C2 idatm_type Car atom id /R:172@N3 idatm_type N2 atom id /R:172@C4 idatm_type Car atom id /R:173@P idatm_type Pac atom id /R:173@OP1 idatm_type O3- atom id /R:173@OP2 idatm_type O3- atom id /R:173@O5' idatm_type O3 atom id /R:173@C5' idatm_type C3 atom id /R:173@C4' idatm_type C3 atom id /R:173@O4' idatm_type O3 atom id /R:173@C3' idatm_type C3 atom id /R:173@O3' idatm_type O3 atom id /R:173@C2' idatm_type C3 atom id /R:173@O2' idatm_type O3 atom id /R:173@C1' idatm_type C3 atom id /R:173@N9 idatm_type Npl atom id /R:173@C8 idatm_type Car atom id /R:173@N7 idatm_type N2 atom id /R:173@C5 idatm_type Car atom id /R:173@C6 idatm_type Car atom id /R:173@N6 idatm_type Npl atom id /R:173@N1 idatm_type N2 atom id /R:173@C2 idatm_type Car atom id /R:173@N3 idatm_type N2 atom id /R:173@C4 idatm_type Car atom id /R:174@P idatm_type Pac atom id /R:174@OP1 idatm_type O3- atom id /R:174@OP2 idatm_type O3- atom id /R:174@O5' idatm_type O3 atom id /R:174@C5' idatm_type C3 atom id /R:174@C4' idatm_type C3 atom id /R:174@O4' idatm_type O3 atom id /R:174@C3' idatm_type C3 atom id /R:174@O3' idatm_type O3 atom id /R:174@C2' idatm_type C3 atom id /R:174@O2' idatm_type O3 atom id /R:174@C1' idatm_type C3 atom id /R:174@N9 idatm_type Npl atom id /R:174@C8 idatm_type Car atom id /R:174@N7 idatm_type N2 atom id /R:174@C5 idatm_type Car atom id /R:174@C6 idatm_type Car atom id /R:174@N6 idatm_type Npl atom id /R:174@N1 idatm_type N2 atom id /R:174@C2 idatm_type Car atom id /R:174@N3 idatm_type N2 atom id /R:174@C4 idatm_type Car atom id /R:175@P idatm_type Pac atom id /R:175@OP1 idatm_type O3- atom id /R:175@OP2 idatm_type O3- atom id /R:175@O5' idatm_type O3 atom id /R:175@C5' idatm_type C3 atom id /R:175@C4' idatm_type C3 atom id /R:175@O4' idatm_type O3 atom id /R:175@C3' idatm_type C3 atom id /R:175@O3' idatm_type O3 atom id /R:175@C2' idatm_type C3 atom id /R:175@O2' idatm_type O3 atom id /R:175@C1' idatm_type C3 atom id /R:175@N9 idatm_type Npl atom id /R:175@C8 idatm_type Car atom id /R:175@N7 idatm_type N2 atom id /R:175@C5 idatm_type Car atom id /R:175@C6 idatm_type Car atom id /R:175@N6 idatm_type Npl atom id /R:175@N1 idatm_type N2 atom id /R:175@C2 idatm_type Car atom id /R:175@N3 idatm_type N2 atom id /R:175@C4 idatm_type Car atom id /R:176@P idatm_type Pac atom id /R:176@OP1 idatm_type O3- atom id /R:176@OP2 idatm_type O3- atom id /R:176@O5' idatm_type O3 atom id /R:176@C5' idatm_type C3 atom id /R:176@C4' idatm_type C3 atom id /R:176@O4' idatm_type O3 atom id /R:176@C3' idatm_type C3 atom id /R:176@O3' idatm_type O3 atom id /R:176@C2' idatm_type C3 atom id /R:176@O2' idatm_type O3 atom id /R:176@C1' idatm_type C3 atom id /R:176@N9 idatm_type Npl atom id /R:176@C8 idatm_type Car atom id /R:176@N7 idatm_type N2 atom id /R:176@C5 idatm_type Car atom id /R:176@C6 idatm_type Car atom id /R:176@N6 idatm_type Npl atom id /R:176@N1 idatm_type N2 atom id /R:176@C2 idatm_type Car atom id /R:176@N3 idatm_type N2 atom id /R:176@C4 idatm_type Car atom id /R:177@P idatm_type Pac atom id /R:177@OP1 idatm_type O3- atom id /R:177@OP2 idatm_type O3- atom id /R:177@O5' idatm_type O3 atom id /R:177@C5' idatm_type C3 atom id /R:177@C4' idatm_type C3 atom id /R:177@O4' idatm_type O3 atom id /R:177@C3' idatm_type C3 atom id /R:177@O3' idatm_type O3 atom id /R:177@C2' idatm_type C3 atom id /R:177@O2' idatm_type O3 atom id /R:177@C1' idatm_type C3 atom id /R:177@N1 idatm_type Npl atom id /R:177@C2 idatm_type C2 atom id /R:177@O2 idatm_type O2 atom id /R:177@N3 idatm_type Npl atom id /R:177@C4 idatm_type C2 atom id /R:177@O4 idatm_type O2 atom id /R:177@C5 idatm_type C2 atom id /R:177@C6 idatm_type C2 atom id /R:178@P idatm_type Pac atom id /R:178@OP1 idatm_type O3- atom id /R:178@OP2 idatm_type O3- atom id /R:178@O5' idatm_type O3 atom id /R:178@C5' idatm_type C3 atom id /R:178@C4' idatm_type C3 atom id /R:178@O4' idatm_type O3 atom id /R:178@C3' idatm_type C3 atom id /R:178@O3' idatm_type O3 atom id /R:178@C2' idatm_type C3 atom id /R:178@O2' idatm_type O3 atom id /R:178@C1' idatm_type C3 atom id /R:178@N9 idatm_type Npl atom id /R:178@C8 idatm_type Car atom id /R:178@N7 idatm_type N2 atom id /R:178@C5 idatm_type Car atom id /R:178@C6 idatm_type C2 atom id /R:178@O6 idatm_type O2 atom id /R:178@N1 idatm_type Npl atom id /R:178@C2 idatm_type C2 atom id /R:178@N2 idatm_type Npl atom id /R:178@N3 idatm_type N2 atom id /R:178@C4 idatm_type Car atom id /R:179@P idatm_type Pac atom id /R:179@OP1 idatm_type O3- atom id /R:179@OP2 idatm_type O3- atom id /R:179@O5' idatm_type O3 atom id /R:179@C5' idatm_type C3 atom id /R:179@C4' idatm_type C3 atom id /R:179@O4' idatm_type O3 atom id /R:179@C3' idatm_type C3 atom id /R:179@O3' idatm_type O3 atom id /R:179@C2' idatm_type C3 atom id /R:179@O2' idatm_type O3 atom id /R:179@C1' idatm_type C3 atom id /R:179@N1 idatm_type Npl atom id /R:179@C2 idatm_type C2 atom id /R:179@O2 idatm_type O2 atom id /R:179@N3 idatm_type Npl atom id /R:179@C4 idatm_type C2 atom id /R:179@O4 idatm_type O2 atom id /R:179@C5 idatm_type C2 atom id /R:179@C6 idatm_type C2 atom id /R:180@P idatm_type Pac atom id /R:180@OP1 idatm_type O3- atom id /R:180@OP2 idatm_type O3- atom id /R:180@O5' idatm_type O3 atom id /R:180@C5' idatm_type C3 atom id /R:180@C4' idatm_type C3 atom id /R:180@O4' idatm_type O3 atom id /R:180@C3' idatm_type C3 atom id /R:180@O3' idatm_type O3 atom id /R:180@C2' idatm_type C3 atom id /R:180@O2' idatm_type O3 atom id /R:180@C1' idatm_type C3 atom id /R:180@N1 idatm_type Npl atom id /R:180@C2 idatm_type C2 atom id /R:180@O2 idatm_type O2 atom id /R:180@N3 idatm_type N2 atom id /R:180@C4 idatm_type C2 atom id /R:180@N4 idatm_type Npl atom id /R:180@C5 idatm_type C2 atom id /R:180@C6 idatm_type C2 atom id /R:181@P idatm_type Pac atom id /R:181@OP1 idatm_type O3- atom id /R:181@OP2 idatm_type O3- atom id /R:181@O5' idatm_type O3 atom id /R:181@C5' idatm_type C3 atom id /R:181@C4' idatm_type C3 atom id /R:181@O4' idatm_type O3 atom id /R:181@C3' idatm_type C3 atom id /R:181@O3' idatm_type O3 atom id /R:181@C2' idatm_type C3 atom id /R:181@O2' idatm_type O3 atom id /R:181@C1' idatm_type C3 atom id /R:181@N9 idatm_type Npl atom id /R:181@C8 idatm_type Car atom id /R:181@N7 idatm_type N2 atom id /R:181@C5 idatm_type Car atom id /R:181@C6 idatm_type Car atom id /R:181@N6 idatm_type Npl atom id /R:181@N1 idatm_type N2 atom id /R:181@C2 idatm_type Car atom id /R:181@N3 idatm_type N2 atom id /R:181@C4 idatm_type Car atom id /R:182@P idatm_type Pac atom id /R:182@OP1 idatm_type O3- atom id /R:182@OP2 idatm_type O3- atom id /R:182@O5' idatm_type O3 atom id /R:182@C5' idatm_type C3 atom id /R:182@C4' idatm_type C3 atom id /R:182@O4' idatm_type O3 atom id /R:182@C3' idatm_type C3 atom id /R:182@O3' idatm_type O3 atom id /R:182@C2' idatm_type C3 atom id /R:182@O2' idatm_type O3 atom id /R:182@C1' idatm_type C3 atom id /R:182@N9 idatm_type Npl atom id /R:182@C8 idatm_type Car atom id /R:182@N7 idatm_type N2 atom id /R:182@C5 idatm_type Car atom id /R:182@C6 idatm_type C2 atom id /R:182@O6 idatm_type O2 atom id /R:182@N1 idatm_type Npl atom id /R:182@C2 idatm_type C2 atom id /R:182@N2 idatm_type Npl atom id /R:182@N3 idatm_type N2 atom id /R:182@C4 idatm_type Car atom id /R:183@P idatm_type Pac atom id /R:183@OP1 idatm_type O3- atom id /R:183@OP2 idatm_type O3- atom id /R:183@O5' idatm_type O3 atom id /R:183@C5' idatm_type C3 atom id /R:183@C4' idatm_type C3 atom id /R:183@O4' idatm_type O3 atom id /R:183@C3' idatm_type C3 atom id /R:183@O3' idatm_type O3 atom id /R:183@C2' idatm_type C3 atom id /R:183@O2' idatm_type O3 atom id /R:183@C1' idatm_type C3 atom id /R:183@N1 idatm_type Npl atom id /R:183@C2 idatm_type C2 atom id /R:183@O2 idatm_type O2 atom id /R:183@N3 idatm_type N2 atom id /R:183@C4 idatm_type C2 atom id /R:183@N4 idatm_type Npl atom id /R:183@C5 idatm_type C2 atom id /R:183@C6 idatm_type C2 atom id /R:184@P idatm_type Pac atom id /R:184@OP1 idatm_type O3- atom id /R:184@OP2 idatm_type O3- atom id /R:184@O5' idatm_type O3 atom id /R:184@C5' idatm_type C3 atom id /R:184@C4' idatm_type C3 atom id /R:184@O4' idatm_type O3 atom id /R:184@C3' idatm_type C3 atom id /R:184@O3' idatm_type O3 atom id /R:184@C2' idatm_type C3 atom id /R:184@O2' idatm_type O3 atom id /R:184@C1' idatm_type C3 atom id /R:184@N1 idatm_type Npl atom id /R:184@C2 idatm_type C2 atom id /R:184@O2 idatm_type O2 atom id /R:184@N3 idatm_type Npl atom id /R:184@C4 idatm_type C2 atom id /R:184@O4 idatm_type O2 atom id /R:184@C5 idatm_type C2 atom id /R:184@C6 idatm_type C2 atom id /R:185@P idatm_type Pac atom id /R:185@OP1 idatm_type O3- atom id /R:185@OP2 idatm_type O3- atom id /R:185@O5' idatm_type O3 atom id /R:185@C5' idatm_type C3 atom id /R:185@C4' idatm_type C3 atom id /R:185@O4' idatm_type O3 atom id /R:185@C3' idatm_type C3 atom id /R:185@O3' idatm_type O3 atom id /R:185@C2' idatm_type C3 atom id /R:185@O2' idatm_type O3 atom id /R:185@C1' idatm_type C3 atom id /R:185@N9 idatm_type Npl atom id /R:185@C8 idatm_type Car atom id /R:185@N7 idatm_type N2 atom id /R:185@C5 idatm_type Car atom id /R:185@C6 idatm_type C2 atom id /R:185@O6 idatm_type O2 atom id /R:185@N1 idatm_type Npl atom id /R:185@C2 idatm_type C2 atom id /R:185@N2 idatm_type Npl atom id /R:185@N3 idatm_type N2 atom id /R:185@C4 idatm_type Car atom id /R:186@P idatm_type Pac atom id /R:186@OP1 idatm_type O3- atom id /R:186@OP2 idatm_type O3- atom id /R:186@O5' idatm_type O3 atom id /R:186@C5' idatm_type C3 atom id /R:186@C4' idatm_type C3 atom id /R:186@O4' idatm_type O3 atom id /R:186@C3' idatm_type C3 atom id /R:186@O3' idatm_type O3 atom id /R:186@C2' idatm_type C3 atom id /R:186@O2' idatm_type O3 atom id /R:186@C1' idatm_type C3 atom id /R:186@N1 idatm_type Npl atom id /R:186@C2 idatm_type C2 atom id /R:186@O2 idatm_type O2 atom id /R:186@N3 idatm_type N2 atom id /R:186@C4 idatm_type C2 atom id /R:186@N4 idatm_type Npl atom id /R:186@C5 idatm_type C2 atom id /R:186@C6 idatm_type C2 atom id /R:187@P idatm_type Pac atom id /R:187@OP1 idatm_type O3- atom id /R:187@OP2 idatm_type O3- atom id /R:187@O5' idatm_type O3 atom id /R:187@C5' idatm_type C3 atom id /R:187@C4' idatm_type C3 atom id /R:187@O4' idatm_type O3 atom id /R:187@C3' idatm_type C3 atom id /R:187@O3' idatm_type O3 atom id /R:187@C2' idatm_type C3 atom id /R:187@O2' idatm_type O3 atom id /R:187@C1' idatm_type C3 atom id /R:187@N1 idatm_type Npl atom id /R:187@C2 idatm_type C2 atom id /R:187@O2 idatm_type O2 atom id /R:187@N3 idatm_type Npl atom id /R:187@C4 idatm_type C2 atom id /R:187@O4 idatm_type O2 atom id /R:187@C5 idatm_type C2 atom id /R:187@C6 idatm_type C2 atom id /R:188@P idatm_type Pac atom id /R:188@OP1 idatm_type O3- atom id /R:188@OP2 idatm_type O3- atom id /R:188@O5' idatm_type O3 atom id /R:188@C5' idatm_type C3 atom id /R:188@C4' idatm_type C3 atom id /R:188@O4' idatm_type O3 atom id /R:188@C3' idatm_type C3 atom id /R:188@O3' idatm_type O3 atom id /R:188@C2' idatm_type C3 atom id /R:188@O2' idatm_type O3 atom id /R:188@C1' idatm_type C3 atom id /R:188@N9 idatm_type Npl atom id /R:188@C8 idatm_type Car atom id /R:188@N7 idatm_type N2 atom id /R:188@C5 idatm_type Car atom id /R:188@C6 idatm_type C2 atom id /R:188@O6 idatm_type O2 atom id /R:188@N1 idatm_type Npl atom id /R:188@C2 idatm_type C2 atom id /R:188@N2 idatm_type Npl atom id /R:188@N3 idatm_type N2 atom id /R:188@C4 idatm_type Car atom id /R:189@P idatm_type Pac atom id /R:189@OP1 idatm_type O3- atom id /R:189@OP2 idatm_type O3- atom id /R:189@O5' idatm_type O3 atom id /R:189@C5' idatm_type C3 atom id /R:189@C4' idatm_type C3 atom id /R:189@O4' idatm_type O3 atom id /R:189@C3' idatm_type C3 atom id /R:189@O3' idatm_type O3 atom id /R:189@C2' idatm_type C3 atom id /R:189@O2' idatm_type O3 atom id /R:189@C1' idatm_type C3 atom id /R:189@N9 idatm_type Npl atom id /R:189@C8 idatm_type Car atom id /R:189@N7 idatm_type N2 atom id /R:189@C5 idatm_type Car atom id /R:189@C6 idatm_type C2 atom id /R:189@O6 idatm_type O2 atom id /R:189@N1 idatm_type Npl atom id /R:189@C2 idatm_type C2 atom id /R:189@N2 idatm_type Npl atom id /R:189@N3 idatm_type N2 atom id /R:189@C4 idatm_type Car atom id /R:190@P idatm_type Pac atom id /R:190@OP1 idatm_type O3- atom id /R:190@OP2 idatm_type O3- atom id /R:190@O5' idatm_type O3 atom id /R:190@C5' idatm_type C3 atom id /R:190@C4' idatm_type C3 atom id /R:190@O4' idatm_type O3 atom id /R:190@C3' idatm_type C3 atom id /R:190@O3' idatm_type O3 atom id /R:190@C2' idatm_type C3 atom id /R:190@O2' idatm_type O3 atom id /R:190@C1' idatm_type C3 atom id /R:190@N1 idatm_type Npl atom id /R:190@C2 idatm_type C2 atom id /R:190@O2 idatm_type O2 atom id /R:190@N3 idatm_type N2 atom id /R:190@C4 idatm_type C2 atom id /R:190@N4 idatm_type Npl atom id /R:190@C5 idatm_type C2 atom id /R:190@C6 idatm_type C2 atom id /R:191@P idatm_type Pac atom id /R:191@OP1 idatm_type O3- atom id /R:191@OP2 idatm_type O3- atom id /R:191@O5' idatm_type O3 atom id /R:191@C5' idatm_type C3 atom id /R:191@C4' idatm_type C3 atom id /R:191@O4' idatm_type O3 atom id /R:191@C3' idatm_type C3 atom id /R:191@O3' idatm_type O3 atom id /R:191@C2' idatm_type C3 atom id /R:191@O2' idatm_type O3 atom id /R:191@C1' idatm_type C3 atom id /R:191@N1 idatm_type Npl atom id /R:191@C2 idatm_type C2 atom id /R:191@O2 idatm_type O2 atom id /R:191@N3 idatm_type N2 atom id /R:191@C4 idatm_type C2 atom id /R:191@N4 idatm_type Npl atom id /R:191@C5 idatm_type C2 atom id /R:191@C6 idatm_type C2 atom id /R:192@P idatm_type Pac atom id /R:192@OP1 idatm_type O3- atom id /R:192@OP2 idatm_type O3- atom id /R:192@O5' idatm_type O3 atom id /R:192@C5' idatm_type C3 atom id /R:192@C4' idatm_type C3 atom id /R:192@O4' idatm_type O3 atom id /R:192@C3' idatm_type C3 atom id /R:192@O3' idatm_type O3 atom id /R:192@C2' idatm_type C3 atom id /R:192@O2' idatm_type O3 atom id /R:192@C1' idatm_type C3 atom id /R:192@N1 idatm_type Npl atom id /R:192@C2 idatm_type C2 atom id /R:192@O2 idatm_type O2 atom id /R:192@N3 idatm_type N2 atom id /R:192@C4 idatm_type C2 atom id /R:192@N4 idatm_type Npl atom id /R:192@C5 idatm_type C2 atom id /R:192@C6 idatm_type C2 > info selection atom id /R:163@P idatm_type Pac atom id /R:163@OP1 idatm_type O3- atom id /R:163@OP2 idatm_type O3- atom id /R:163@O5' idatm_type O3 atom id /R:163@C5' idatm_type C3 atom id /R:163@C4' idatm_type C3 atom id /R:163@O4' idatm_type O3 atom id /R:163@C3' idatm_type C3 atom id /R:163@O3' idatm_type O3 atom id /R:163@C2' idatm_type C3 atom id /R:163@O2' idatm_type O3 atom id /R:163@C1' idatm_type C3 atom id /R:163@N9 idatm_type Npl atom id /R:163@C8 idatm_type Car atom id /R:163@N7 idatm_type N2 atom id /R:163@C5 idatm_type Car atom id /R:163@C6 idatm_type C2 atom id /R:163@O6 idatm_type O2 atom id /R:163@N1 idatm_type Npl atom id /R:163@C2 idatm_type C2 atom id /R:163@N2 idatm_type Npl atom id /R:163@N3 idatm_type N2 atom id /R:163@C4 idatm_type Car atom id /R:164@P idatm_type Pac atom id /R:164@OP1 idatm_type O3- atom id /R:164@OP2 idatm_type O3- atom id /R:164@O5' idatm_type O3 atom id /R:164@C5' idatm_type C3 atom id /R:164@C4' idatm_type C3 atom id /R:164@O4' idatm_type O3 atom id /R:164@C3' idatm_type C3 atom id /R:164@O3' idatm_type O3 atom id /R:164@C2' idatm_type C3 atom id /R:164@O2' idatm_type O3 atom id /R:164@C1' idatm_type C3 atom id /R:164@N9 idatm_type Npl atom id /R:164@C8 idatm_type Car atom id /R:164@N7 idatm_type N2 atom id /R:164@C5 idatm_type Car atom id /R:164@C6 idatm_type Car atom id /R:164@N6 idatm_type Npl atom id /R:164@N1 idatm_type N2 atom id /R:164@C2 idatm_type Car atom id /R:164@N3 idatm_type N2 atom id /R:164@C4 idatm_type Car atom id /R:165@P idatm_type Pac atom id /R:165@OP1 idatm_type O3- atom id /R:165@OP2 idatm_type O3- atom id /R:165@O5' idatm_type O3 atom id /R:165@C5' idatm_type C3 atom id /R:165@C4' idatm_type C3 atom id /R:165@O4' idatm_type O3 atom id /R:165@C3' idatm_type C3 atom id /R:165@O3' idatm_type O3 atom id /R:165@C2' idatm_type C3 atom id /R:165@O2' idatm_type O3 atom id /R:165@C1' idatm_type C3 atom id /R:165@N9 idatm_type Npl atom id /R:165@C8 idatm_type Car atom id /R:165@N7 idatm_type N2 atom id /R:165@C5 idatm_type Car atom id /R:165@C6 idatm_type C2 atom id /R:165@O6 idatm_type O2 atom id /R:165@N1 idatm_type Npl atom id /R:165@C2 idatm_type C2 atom id /R:165@N2 idatm_type Npl atom id /R:165@N3 idatm_type N2 atom id /R:165@C4 idatm_type Car atom id /R:166@P idatm_type Pac atom id /R:166@OP1 idatm_type O3- atom id /R:166@OP2 idatm_type O3- atom id /R:166@O5' idatm_type O3 atom id /R:166@C5' idatm_type C3 atom id /R:166@C4' idatm_type C3 atom id /R:166@O4' idatm_type O3 atom id /R:166@C3' idatm_type C3 atom id /R:166@O3' idatm_type O3 atom id /R:166@C2' idatm_type C3 atom id /R:166@O2' idatm_type O3 atom id /R:166@C1' idatm_type C3 atom id /R:166@N1 idatm_type Npl atom id /R:166@C2 idatm_type C2 atom id /R:166@O2 idatm_type O2 atom id /R:166@N3 idatm_type N2 atom id /R:166@C4 idatm_type C2 atom id /R:166@N4 idatm_type Npl atom id /R:166@C5 idatm_type C2 atom id /R:166@C6 idatm_type C2 atom id /R:167@P idatm_type Pac atom id /R:167@OP1 idatm_type O3- atom id /R:167@OP2 idatm_type O3- atom id /R:167@O5' idatm_type O3 atom id /R:167@C5' idatm_type C3 atom id /R:167@C4' idatm_type C3 atom id /R:167@O4' idatm_type O3 atom id /R:167@C3' idatm_type C3 atom id /R:167@O3' idatm_type O3 atom id /R:167@C2' idatm_type C3 atom id /R:167@O2' idatm_type O3 atom id /R:167@C1' idatm_type C3 atom id /R:167@N9 idatm_type Npl atom id /R:167@C8 idatm_type Car atom id /R:167@N7 idatm_type N2 atom id /R:167@C5 idatm_type Car atom id /R:167@C6 idatm_type Car atom id /R:167@N6 idatm_type Npl atom id /R:167@N1 idatm_type N2 atom id /R:167@C2 idatm_type Car atom id /R:167@N3 idatm_type N2 atom id /R:167@C4 idatm_type Car atom id /R:168@P idatm_type Pac atom id /R:168@OP1 idatm_type O3- atom id /R:168@OP2 idatm_type O3- atom id /R:168@O5' idatm_type O3 atom id /R:168@C5' idatm_type C3 atom id /R:168@C4' idatm_type C3 atom id /R:168@O4' idatm_type O3 atom id /R:168@C3' idatm_type C3 atom id /R:168@O3' idatm_type O3 atom id /R:168@C2' idatm_type C3 atom id /R:168@O2' idatm_type O3 atom id /R:168@C1' idatm_type C3 atom id /R:168@N9 idatm_type Npl atom id /R:168@C8 idatm_type Car atom id /R:168@N7 idatm_type N2 atom id /R:168@C5 idatm_type Car atom id /R:168@C6 idatm_type Car atom id /R:168@N6 idatm_type Npl atom id /R:168@N1 idatm_type N2 atom id /R:168@C2 idatm_type Car atom id /R:168@N3 idatm_type N2 atom id /R:168@C4 idatm_type Car atom id /R:169@P idatm_type Pac atom id /R:169@OP1 idatm_type O3- atom id /R:169@OP2 idatm_type O3- atom id /R:169@O5' idatm_type O3 atom id /R:169@C5' idatm_type C3 atom id /R:169@C4' idatm_type C3 atom id /R:169@O4' idatm_type O3 atom id /R:169@C3' idatm_type C3 atom id /R:169@O3' idatm_type O3 atom id /R:169@C2' idatm_type C3 atom id /R:169@O2' idatm_type O3 atom id /R:169@C1' idatm_type C3 atom id /R:169@N9 idatm_type Npl atom id /R:169@C8 idatm_type Car atom id /R:169@N7 idatm_type N2 atom id /R:169@C5 idatm_type Car atom id /R:169@C6 idatm_type Car atom id /R:169@N6 idatm_type Npl atom id /R:169@N1 idatm_type N2 atom id /R:169@C2 idatm_type Car atom id /R:169@N3 idatm_type N2 atom id /R:169@C4 idatm_type Car atom id /R:170@P idatm_type Pac atom id /R:170@OP1 idatm_type O3- atom id /R:170@OP2 idatm_type O3- atom id /R:170@O5' idatm_type O3 atom id /R:170@C5' idatm_type C3 atom id /R:170@C4' idatm_type C3 atom id /R:170@O4' idatm_type O3 atom id /R:170@C3' idatm_type C3 atom id /R:170@O3' idatm_type O3 atom id /R:170@C2' idatm_type C3 atom id /R:170@O2' idatm_type O3 atom id /R:170@C1' idatm_type C3 atom id /R:170@N1 idatm_type Npl atom id /R:170@C2 idatm_type C2 atom id /R:170@O2 idatm_type O2 atom id /R:170@N3 idatm_type N2 atom id /R:170@C4 idatm_type C2 atom id /R:170@N4 idatm_type Npl atom id /R:170@C5 idatm_type C2 atom id /R:170@C6 idatm_type C2 atom id /R:171@P idatm_type Pac atom id /R:171@OP1 idatm_type O3- atom id /R:171@OP2 idatm_type O3- atom id /R:171@O5' idatm_type O3 atom id /R:171@C5' idatm_type C3 atom id /R:171@C4' idatm_type C3 atom id /R:171@O4' idatm_type O3 atom id /R:171@C3' idatm_type C3 atom id /R:171@O3' idatm_type O3 atom id /R:171@C2' idatm_type C3 atom id /R:171@O2' idatm_type O3 atom id /R:171@C1' idatm_type C3 atom id /R:171@N9 idatm_type Npl atom id /R:171@C8 idatm_type Car atom id /R:171@N7 idatm_type N2 atom id /R:171@C5 idatm_type Car atom id /R:171@C6 idatm_type Car atom id /R:171@N6 idatm_type Npl atom id /R:171@N1 idatm_type N2 atom id /R:171@C2 idatm_type Car atom id /R:171@N3 idatm_type N2 atom id /R:171@C4 idatm_type Car atom id /R:172@P idatm_type Pac atom id /R:172@OP1 idatm_type O3- atom id /R:172@OP2 idatm_type O3- atom id /R:172@O5' idatm_type O3 atom id /R:172@C5' idatm_type C3 atom id /R:172@C4' idatm_type C3 atom id /R:172@O4' idatm_type O3 atom id /R:172@C3' idatm_type C3 atom id /R:172@O3' idatm_type O3 atom id /R:172@C2' idatm_type C3 atom id /R:172@O2' idatm_type O3 atom id /R:172@C1' idatm_type C3 atom id /R:172@N9 idatm_type Npl atom id /R:172@C8 idatm_type Car atom id /R:172@N7 idatm_type N2 atom id /R:172@C5 idatm_type Car atom id /R:172@C6 idatm_type Car atom id /R:172@N6 idatm_type Npl atom id /R:172@N1 idatm_type N2 atom id /R:172@C2 idatm_type Car atom id /R:172@N3 idatm_type N2 atom id /R:172@C4 idatm_type Car atom id /R:173@P idatm_type Pac atom id /R:173@OP1 idatm_type O3- atom id /R:173@OP2 idatm_type O3- atom id /R:173@O5' idatm_type O3 atom id /R:173@C5' idatm_type C3 atom id /R:173@C4' idatm_type C3 atom id /R:173@O4' idatm_type O3 atom id /R:173@C3' idatm_type C3 atom id /R:173@O3' idatm_type O3 atom id /R:173@C2' idatm_type C3 atom id /R:173@O2' idatm_type O3 atom id /R:173@C1' idatm_type C3 atom id /R:173@N9 idatm_type Npl atom id /R:173@C8 idatm_type Car atom id /R:173@N7 idatm_type N2 atom id /R:173@C5 idatm_type Car atom id /R:173@C6 idatm_type Car atom id /R:173@N6 idatm_type Npl atom id /R:173@N1 idatm_type N2 atom id /R:173@C2 idatm_type Car atom id /R:173@N3 idatm_type N2 atom id /R:173@C4 idatm_type Car atom id /R:174@P idatm_type Pac atom id /R:174@OP1 idatm_type O3- atom id /R:174@OP2 idatm_type O3- atom id /R:174@O5' idatm_type O3 atom id /R:174@C5' idatm_type C3 atom id /R:174@C4' idatm_type C3 atom id /R:174@O4' idatm_type O3 atom id /R:174@C3' idatm_type C3 atom id /R:174@O3' idatm_type O3 atom id /R:174@C2' idatm_type C3 atom id /R:174@O2' idatm_type O3 atom id /R:174@C1' idatm_type C3 atom id /R:174@N9 idatm_type Npl atom id /R:174@C8 idatm_type Car atom id /R:174@N7 idatm_type N2 atom id /R:174@C5 idatm_type Car atom id /R:174@C6 idatm_type Car atom id /R:174@N6 idatm_type Npl atom id /R:174@N1 idatm_type N2 atom id /R:174@C2 idatm_type Car atom id /R:174@N3 idatm_type N2 atom id /R:174@C4 idatm_type Car atom id /R:175@P idatm_type Pac atom id /R:175@OP1 idatm_type O3- atom id /R:175@OP2 idatm_type O3- atom id /R:175@O5' idatm_type O3 atom id /R:175@C5' idatm_type C3 atom id /R:175@C4' idatm_type C3 atom id /R:175@O4' idatm_type O3 atom id /R:175@C3' idatm_type C3 atom id /R:175@O3' idatm_type O3 atom id /R:175@C2' idatm_type C3 atom id /R:175@O2' idatm_type O3 atom id /R:175@C1' idatm_type C3 atom id /R:175@N9 idatm_type Npl atom id /R:175@C8 idatm_type Car atom id /R:175@N7 idatm_type N2 atom id /R:175@C5 idatm_type Car atom id /R:175@C6 idatm_type Car atom id /R:175@N6 idatm_type Npl atom id /R:175@N1 idatm_type N2 atom id /R:175@C2 idatm_type Car atom id /R:175@N3 idatm_type N2 atom id /R:175@C4 idatm_type Car atom id /R:176@P idatm_type Pac atom id /R:176@OP1 idatm_type O3- atom id /R:176@OP2 idatm_type O3- atom id /R:176@O5' idatm_type O3 atom id /R:176@C5' idatm_type C3 atom id /R:176@C4' idatm_type C3 atom id /R:176@O4' idatm_type O3 atom id /R:176@C3' idatm_type C3 atom id /R:176@O3' idatm_type O3 atom id /R:176@C2' idatm_type C3 atom id /R:176@O2' idatm_type O3 atom id /R:176@C1' idatm_type C3 atom id /R:176@N9 idatm_type Npl atom id /R:176@C8 idatm_type Car atom id /R:176@N7 idatm_type N2 atom id /R:176@C5 idatm_type Car atom id /R:176@C6 idatm_type Car atom id /R:176@N6 idatm_type Npl atom id /R:176@N1 idatm_type N2 atom id /R:176@C2 idatm_type Car atom id /R:176@N3 idatm_type N2 atom id /R:176@C4 idatm_type Car atom id /R:177@P idatm_type Pac atom id /R:177@OP1 idatm_type O3- atom id /R:177@OP2 idatm_type O3- atom id /R:177@O5' idatm_type O3 atom id /R:177@C5' idatm_type C3 atom id /R:177@C4' idatm_type C3 atom id /R:177@O4' idatm_type O3 atom id /R:177@C3' idatm_type C3 atom id /R:177@O3' idatm_type O3 atom id /R:177@C2' idatm_type C3 atom id /R:177@O2' idatm_type O3 atom id /R:177@C1' idatm_type C3 atom id /R:177@N1 idatm_type Npl atom id /R:177@C2 idatm_type C2 atom id /R:177@O2 idatm_type O2 atom id /R:177@N3 idatm_type Npl atom id /R:177@C4 idatm_type C2 atom id /R:177@O4 idatm_type O2 atom id /R:177@C5 idatm_type C2 atom id /R:177@C6 idatm_type C2 atom id /R:178@P idatm_type Pac atom id /R:178@OP1 idatm_type O3- atom id /R:178@OP2 idatm_type O3- atom id /R:178@O5' idatm_type O3 atom id /R:178@C5' idatm_type C3 atom id /R:178@C4' idatm_type C3 atom id /R:178@O4' idatm_type O3 atom id /R:178@C3' idatm_type C3 atom id /R:178@O3' idatm_type O3 atom id /R:178@C2' idatm_type C3 atom id /R:178@O2' idatm_type O3 atom id /R:178@C1' idatm_type C3 atom id /R:178@N9 idatm_type Npl atom id /R:178@C8 idatm_type Car atom id /R:178@N7 idatm_type N2 atom id /R:178@C5 idatm_type Car atom id /R:178@C6 idatm_type C2 atom id /R:178@O6 idatm_type O2 atom id /R:178@N1 idatm_type Npl atom id /R:178@C2 idatm_type C2 atom id /R:178@N2 idatm_type Npl atom id /R:178@N3 idatm_type N2 atom id /R:178@C4 idatm_type Car atom id /R:179@P idatm_type Pac atom id /R:179@OP1 idatm_type O3- atom id /R:179@OP2 idatm_type O3- atom id /R:179@O5' idatm_type O3 atom id /R:179@C5' idatm_type C3 atom id /R:179@C4' idatm_type C3 atom id /R:179@O4' idatm_type O3 atom id /R:179@C3' idatm_type C3 atom id /R:179@O3' idatm_type O3 atom id /R:179@C2' idatm_type C3 atom id /R:179@O2' idatm_type O3 atom id /R:179@C1' idatm_type C3 atom id /R:179@N1 idatm_type Npl atom id /R:179@C2 idatm_type C2 atom id /R:179@O2 idatm_type O2 atom id /R:179@N3 idatm_type Npl atom id /R:179@C4 idatm_type C2 atom id /R:179@O4 idatm_type O2 atom id /R:179@C5 idatm_type C2 atom id /R:179@C6 idatm_type C2 atom id /R:180@P idatm_type Pac atom id /R:180@OP1 idatm_type O3- atom id /R:180@OP2 idatm_type O3- atom id /R:180@O5' idatm_type O3 atom id /R:180@C5' idatm_type C3 atom id /R:180@C4' idatm_type C3 atom id /R:180@O4' idatm_type O3 atom id /R:180@C3' idatm_type C3 atom id /R:180@O3' idatm_type O3 atom id /R:180@C2' idatm_type C3 atom id /R:180@O2' idatm_type O3 atom id /R:180@C1' idatm_type C3 atom id /R:180@N1 idatm_type Npl atom id /R:180@C2 idatm_type C2 atom id /R:180@O2 idatm_type O2 atom id /R:180@N3 idatm_type N2 atom id /R:180@C4 idatm_type C2 atom id /R:180@N4 idatm_type Npl atom id /R:180@C5 idatm_type C2 atom id /R:180@C6 idatm_type C2 atom id /R:181@P idatm_type Pac atom id /R:181@OP1 idatm_type O3- atom id /R:181@OP2 idatm_type O3- atom id /R:181@O5' idatm_type O3 atom id /R:181@C5' idatm_type C3 atom id /R:181@C4' idatm_type C3 atom id /R:181@O4' idatm_type O3 atom id /R:181@C3' idatm_type C3 atom id /R:181@O3' idatm_type O3 atom id /R:181@C2' idatm_type C3 atom id /R:181@O2' idatm_type O3 atom id /R:181@C1' idatm_type C3 atom id /R:181@N9 idatm_type Npl atom id /R:181@C8 idatm_type Car atom id /R:181@N7 idatm_type N2 atom id /R:181@C5 idatm_type Car atom id /R:181@C6 idatm_type Car atom id /R:181@N6 idatm_type Npl atom id /R:181@N1 idatm_type N2 atom id /R:181@C2 idatm_type Car atom id /R:181@N3 idatm_type N2 atom id /R:181@C4 idatm_type Car atom id /R:182@P idatm_type Pac atom id /R:182@OP1 idatm_type O3- atom id /R:182@OP2 idatm_type O3- atom id /R:182@O5' idatm_type O3 atom id /R:182@C5' idatm_type C3 atom id /R:182@C4' idatm_type C3 atom id /R:182@O4' idatm_type O3 atom id /R:182@C3' idatm_type C3 atom id /R:182@O3' idatm_type O3 atom id /R:182@C2' idatm_type C3 atom id /R:182@O2' idatm_type O3 atom id /R:182@C1' idatm_type C3 atom id /R:182@N9 idatm_type Npl atom id /R:182@C8 idatm_type Car atom id /R:182@N7 idatm_type N2 atom id /R:182@C5 idatm_type Car atom id /R:182@C6 idatm_type C2 atom id /R:182@O6 idatm_type O2 atom id /R:182@N1 idatm_type Npl atom id /R:182@C2 idatm_type C2 atom id /R:182@N2 idatm_type Npl atom id /R:182@N3 idatm_type N2 atom id /R:182@C4 idatm_type Car atom id /R:183@P idatm_type Pac atom id /R:183@OP1 idatm_type O3- atom id /R:183@OP2 idatm_type O3- atom id /R:183@O5' idatm_type O3 atom id /R:183@C5' idatm_type C3 atom id /R:183@C4' idatm_type C3 atom id /R:183@O4' idatm_type O3 atom id /R:183@C3' idatm_type C3 atom id /R:183@O3' idatm_type O3 atom id /R:183@C2' idatm_type C3 atom id /R:183@O2' idatm_type O3 atom id /R:183@C1' idatm_type C3 atom id /R:183@N1 idatm_type Npl atom id /R:183@C2 idatm_type C2 atom id /R:183@O2 idatm_type O2 atom id /R:183@N3 idatm_type N2 atom id /R:183@C4 idatm_type C2 atom id /R:183@N4 idatm_type Npl atom id /R:183@C5 idatm_type C2 atom id /R:183@C6 idatm_type C2 atom id /R:184@P idatm_type Pac atom id /R:184@OP1 idatm_type O3- atom id /R:184@OP2 idatm_type O3- atom id /R:184@O5' idatm_type O3 atom id /R:184@C5' idatm_type C3 atom id /R:184@C4' idatm_type C3 atom id /R:184@O4' idatm_type O3 atom id /R:184@C3' idatm_type C3 atom id /R:184@O3' idatm_type O3 atom id /R:184@C2' idatm_type C3 atom id /R:184@O2' idatm_type O3 atom id /R:184@C1' idatm_type C3 atom id /R:184@N1 idatm_type Npl atom id /R:184@C2 idatm_type C2 atom id /R:184@O2 idatm_type O2 atom id /R:184@N3 idatm_type Npl atom id /R:184@C4 idatm_type C2 atom id /R:184@O4 idatm_type O2 atom id /R:184@C5 idatm_type C2 atom id /R:184@C6 idatm_type C2 atom id /R:185@P idatm_type Pac atom id /R:185@OP1 idatm_type O3- atom id /R:185@OP2 idatm_type O3- atom id /R:185@O5' idatm_type O3 atom id /R:185@C5' idatm_type C3 atom id /R:185@C4' idatm_type C3 atom id /R:185@O4' idatm_type O3 atom id /R:185@C3' idatm_type C3 atom id /R:185@O3' idatm_type O3 atom id /R:185@C2' idatm_type C3 atom id /R:185@O2' idatm_type O3 atom id /R:185@C1' idatm_type C3 atom id /R:185@N9 idatm_type Npl atom id /R:185@C8 idatm_type Car atom id /R:185@N7 idatm_type N2 atom id /R:185@C5 idatm_type Car atom id /R:185@C6 idatm_type C2 atom id /R:185@O6 idatm_type O2 atom id /R:185@N1 idatm_type Npl atom id /R:185@C2 idatm_type C2 atom id /R:185@N2 idatm_type Npl atom id /R:185@N3 idatm_type N2 atom id /R:185@C4 idatm_type Car atom id /R:186@P idatm_type Pac atom id /R:186@OP1 idatm_type O3- atom id /R:186@OP2 idatm_type O3- atom id /R:186@O5' idatm_type O3 atom id /R:186@C5' idatm_type C3 atom id /R:186@C4' idatm_type C3 atom id /R:186@O4' idatm_type O3 atom id /R:186@C3' idatm_type C3 atom id /R:186@O3' idatm_type O3 atom id /R:186@C2' idatm_type C3 atom id /R:186@O2' idatm_type O3 atom id /R:186@C1' idatm_type C3 atom id /R:186@N1 idatm_type Npl atom id /R:186@C2 idatm_type C2 atom id /R:186@O2 idatm_type O2 atom id /R:186@N3 idatm_type N2 atom id /R:186@C4 idatm_type C2 atom id /R:186@N4 idatm_type Npl atom id /R:186@C5 idatm_type C2 atom id /R:186@C6 idatm_type C2 atom id /R:187@P idatm_type Pac atom id /R:187@OP1 idatm_type O3- atom id /R:187@OP2 idatm_type O3- atom id /R:187@O5' idatm_type O3 atom id /R:187@C5' idatm_type C3 atom id /R:187@C4' idatm_type C3 atom id /R:187@O4' idatm_type O3 atom id /R:187@C3' idatm_type C3 atom id /R:187@O3' idatm_type O3 atom id /R:187@C2' idatm_type C3 atom id /R:187@O2' idatm_type O3 atom id /R:187@C1' idatm_type C3 atom id /R:187@N1 idatm_type Npl atom id /R:187@C2 idatm_type C2 atom id /R:187@O2 idatm_type O2 atom id /R:187@N3 idatm_type Npl atom id /R:187@C4 idatm_type C2 atom id /R:187@O4 idatm_type O2 atom id /R:187@C5 idatm_type C2 atom id /R:187@C6 idatm_type C2 atom id /R:188@P idatm_type Pac atom id /R:188@OP1 idatm_type O3- atom id /R:188@OP2 idatm_type O3- atom id /R:188@O5' idatm_type O3 atom id /R:188@C5' idatm_type C3 atom id /R:188@C4' idatm_type C3 atom id /R:188@O4' idatm_type O3 atom id /R:188@C3' idatm_type C3 atom id /R:188@O3' idatm_type O3 atom id /R:188@C2' idatm_type C3 atom id /R:188@O2' idatm_type O3 atom id /R:188@C1' idatm_type C3 atom id /R:188@N9 idatm_type Npl atom id /R:188@C8 idatm_type Car atom id /R:188@N7 idatm_type N2 atom id /R:188@C5 idatm_type Car atom id /R:188@C6 idatm_type C2 atom id /R:188@O6 idatm_type O2 atom id /R:188@N1 idatm_type Npl atom id /R:188@C2 idatm_type C2 atom id /R:188@N2 idatm_type Npl atom id /R:188@N3 idatm_type N2 atom id /R:188@C4 idatm_type Car atom id /R:189@P idatm_type Pac atom id /R:189@OP1 idatm_type O3- atom id /R:189@OP2 idatm_type O3- atom id /R:189@O5' idatm_type O3 atom id /R:189@C5' idatm_type C3 atom id /R:189@C4' idatm_type C3 atom id /R:189@O4' idatm_type O3 atom id /R:189@C3' idatm_type C3 atom id /R:189@O3' idatm_type O3 atom id /R:189@C2' idatm_type C3 atom id /R:189@O2' idatm_type O3 atom id /R:189@C1' idatm_type C3 atom id /R:189@N9 idatm_type Npl atom id /R:189@C8 idatm_type Car atom id /R:189@N7 idatm_type N2 atom id /R:189@C5 idatm_type Car atom id /R:189@C6 idatm_type C2 atom id /R:189@O6 idatm_type O2 atom id /R:189@N1 idatm_type Npl atom id /R:189@C2 idatm_type C2 atom id /R:189@N2 idatm_type Npl atom id /R:189@N3 idatm_type N2 atom id /R:189@C4 idatm_type Car atom id /R:190@P idatm_type Pac atom id /R:190@OP1 idatm_type O3- atom id /R:190@OP2 idatm_type O3- atom id /R:190@O5' idatm_type O3 atom id /R:190@C5' idatm_type C3 atom id /R:190@C4' idatm_type C3 atom id /R:190@O4' idatm_type O3 atom id /R:190@C3' idatm_type C3 atom id /R:190@O3' idatm_type O3 atom id /R:190@C2' idatm_type C3 atom id /R:190@O2' idatm_type O3 atom id /R:190@C1' idatm_type C3 atom id /R:190@N1 idatm_type Npl atom id /R:190@C2 idatm_type C2 atom id /R:190@O2 idatm_type O2 atom id /R:190@N3 idatm_type N2 atom id /R:190@C4 idatm_type C2 atom id /R:190@N4 idatm_type Npl atom id /R:190@C5 idatm_type C2 atom id /R:190@C6 idatm_type C2 atom id /R:191@P idatm_type Pac atom id /R:191@OP1 idatm_type O3- atom id /R:191@OP2 idatm_type O3- atom id /R:191@O5' idatm_type O3 atom id /R:191@C5' idatm_type C3 atom id /R:191@C4' idatm_type C3 atom id /R:191@O4' idatm_type O3 atom id /R:191@C3' idatm_type C3 atom id /R:191@O3' idatm_type O3 atom id /R:191@C2' idatm_type C3 atom id /R:191@O2' idatm_type O3 atom id /R:191@C1' idatm_type C3 atom id /R:191@N1 idatm_type Npl atom id /R:191@C2 idatm_type C2 atom id /R:191@O2 idatm_type O2 atom id /R:191@N3 idatm_type N2 atom id /R:191@C4 idatm_type C2 atom id /R:191@N4 idatm_type Npl atom id /R:191@C5 idatm_type C2 atom id /R:191@C6 idatm_type C2 atom id /R:192@P idatm_type Pac atom id /R:192@OP1 idatm_type O3- atom id /R:192@OP2 idatm_type O3- atom id /R:192@O5' idatm_type O3 atom id /R:192@C5' idatm_type C3 atom id /R:192@C4' idatm_type C3 atom id /R:192@O4' idatm_type O3 atom id /R:192@C3' idatm_type C3 atom id /R:192@O3' idatm_type O3 atom id /R:192@C2' idatm_type C3 atom id /R:192@O2' idatm_type O3 atom id /R:192@C1' idatm_type C3 atom id /R:192@N1 idatm_type Npl atom id /R:192@C2 idatm_type C2 atom id /R:192@O2 idatm_type O2 atom id /R:192@N3 idatm_type N2 atom id /R:192@C4 idatm_type C2 atom id /R:192@N4 idatm_type Npl atom id /R:192@C5 idatm_type C2 atom id /R:192@C6 idatm_type C2 > info traptr 1 models #1, 7v99, shown 14582 atoms, 15404 bonds, 1419 residues, 5 chains (A,K,L,R,S) 193 hydrogen bonds, 3 missing structure > info beforetraptr1 1 models #1, 7v99, shown 14582 atoms, 15404 bonds, 1419 residues, 5 chains (A,K,L,R,S) 193 hydrogen bonds, 3 missing structure > info matt Expected a models specifier or a keyword > color beforetraptr1 green > color beforetraptr2 red > name list before_traptr sel beforetr1 sel beforetraptr1 sel beforetraptr2 sel test1 sel trapping_TR sel traptr sel > select protein 9299 atoms, 9512 bonds, 1 pseudobond, 1170 residues, 2 models selected > color test1 red > color traptr blue > name delete all > name list There are no user-defined specifier names. > name traptr select /r:237-334 ""select /r:237-334"": invalid atom specifier > name traptr selection /r:237-334 ""selection /r:237-334"": invalid atom specifier > name traptr /r:237-334 > name before_traptr1 /r:33-147 > name before_traptr2 /r:163-192 > name before_traptr /r:33-192 > color /a blue > color /a lightblue > color /j green > color /k green > color /k lightgreen > color /l lightred Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero', 'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms', 'fromcartoons', 'fromribbons', or 'random' or a keyword > color /l lightred Expected a color or one of 'byatom', 'bychain', 'byelement', 'byhetero', 'byidentity', 'bymodel', 'bynucleotide', 'bypolymer', 'fromatoms', 'fromcartoons', 'fromribbons', or 'random' or a keyword > color /l green > lighting soft > color before_traptr pink > save ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" ——— End of log from Thu Jun 8 16:55:49 2023 ——— opened ChimeraX session UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. How to cite UCSF ChimeraX > color before_traptr red > color before_traptr pink > lighting simple [Repeated 1 time(s)] > lighting soft [Repeated 2 time(s)] > lighting full > lighting soft [Repeated 1 time(s)] > transparency /a 50 > transparency /a 40 > transparency /a 20 > transparency /a 10 > transparency /a 90 > transparency /a 0 > transparency /a 5 > hide /a atoms > hide /a surfaces > show /a surfaces > selection /a Unknown command: selection /a > select /a 7898 atoms, 8092 bonds, 1 pseudobond, 991 residues, 2 models selected > color sel byhetero > color sel bychain > color sel bypolymer > rainbow sel > color sel bychain > hide sel atoms > hide sel cartoons > hide sel surfaces > show sel surfaces > surface style #1.3 mesh > surface style #1.3 dot > surface style #1.3 solid > transparency (#!1 & sel) 100 > transparency (#!1 & sel) 90 > transparency (#!1 & sel) 70 > save ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" > ui tool show ""Surface Color"" > ui tool show ""File History"" > ui tool show AlphaFold > alphafold match #1/A Fetching AlphaFold database settings from https://www.rbvi.ucsf.edu/chimerax/data/status/alphafold_database3.json Fetching compressed AlphaFold O14746 from https://alphafold.ebi.ac.uk/files/AF-O14746-F1-model_v4.cif 1 AlphaFold model found using UniProt identifier: O14746 (chain A) AlphaFold prediction matching 7v99 --- Chain| UniProt Id| UniProt Name| RMSD| Length| Seen| % Id A | O14746 | TERT_HUMAN | 5.03 | 1132 | 991 | 100 Opened 1 AlphaFold model > hide #!2 models > show #!2 models > hide #!2 models > hide target m > show target m > hide #!2 models > close #2 > roll [Repeated 1 time(s)] > roll stop Expected an axis vector or a keyword > roll off Expected an axis vector or a keyword > stop > tile 2 Expected a models specifier or a keyword > select /R:33-192 3069 atoms, 3422 bonds, 104 pseudobonds, 145 residues, 3 models selected Unsupported scale factor (0.000000) detected on Display0 [Repeated 4 time(s)] > select /R 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > select /R 5156 atoms, 5750 bonds, 186 pseudobonds, 243 residues, 3 models selected > hide beforetraptr Expected a collection of one of 'atoms', 'bonds', 'cartoons', 'models', 'pbonds', 'pseudobonds', 'ribbons', or 'surfaces' or a keyword > name list before_traptr /r:33-192 before_traptr1 /r:33-147 before_traptr2 /r:163-192 beforetr1 sel beforetraptr1 sel test1 sel trapping_TR sel traptr /r:237-334 > hide before_traptr > hide before_traptr atoms, ribbons > hide /a > hide /a surfaces > hide /s atoms, ribbons > name long_loop_hp selection /r:276-2279 ""selection /r:276-2279"": invalid atom specifier > name long_loop_hp selection /r:276-279 ""selection /r:276-279"": invalid atom specifier > name long_loop_hp select /r:276-279 ""select /r:276-279"": invalid atom specifier > name long_loop_hp /r:276-279 > color long_loop_hp red > save ""/Users/matthewcomstock/Library/CloudStorage/OneDrive- > MichiganStateUniversity/project analysis/230308 telomerase RNA > structure/telomerase structures/7v99 chimera work.cxs"" ——— End of log from Mon Jun 12 09:55:11 2023 ——— opened ChimeraX session UCSF ChimeraX version: 1.6.1 (2023-05-09) © 2016-2023 Regents of the University of California. All rights reserved. How to cite UCSF ChimeraX OpenGL version: 4.1 INTEL-20.5.7 OpenGL renderer: Intel(R) Iris(TM) Plus Graphics 655 OpenGL vendor: Intel Inc. Python: 3.9.11 Locale: UTF-8 Qt version: PyQt6 6.4.2, Qt 6.4.2 Qt runtime version: 6.4.3 Qt platform: cocoa Hardware: Hardware Overview: Model Name: MacBook Pro Model Identifier: MacBookPro15,2 Processor Name: Quad-Core Intel Core i5 Processor Speed: 2.4 GHz Number of Processors: 1 Total Number of Cores: 4 L2 Cache (per Core): 256 KB L3 Cache: 6 MB Hyper-Threading Technology: Enabled Memory: 8 GB System Firmware Version: 1968.100.17.0.0 (iBridge: 20.16.4252.0.0,0) OS Loader Version: 577~129 Software: System Software Overview: System Version: macOS 13.3.1 (a) (22E772610a) Kernel Version: Darwin 22.4.0 Time since boot: 18 days, 10 minutes Graphics/Displays: Intel Iris Plus Graphics 655: Chipset Model: Intel Iris Plus Graphics 655 Type: GPU Bus: Built-In VRAM (Dynamic, Max): 1536 MB Vendor: Intel Device ID: 0x3ea5 Revision ID: 0x0001 Metal Support: Metal 3 Displays: Color LCD: Display Type: Built-In Retina LCD Resolution: 2560 x 1600 Retina Framebuffer Depth: 24-Bit Color (ARGB8888) Mirror: Off Online: Yes Automatically Adjust Brightness: Yes Connection Type: Internal Thunderbolt Display: Display Type: LCD Resolution: 2560 x 1440 (QHD/WQHD - Wide Quad High Definition) UI Looks like: 2560 x 1440 Framebuffer Depth: 30-Bit Color (ARGB2101010) Display Serial Number: C02HV216F2GC Main Display: Yes Mirror: Off Online: Yes Rotation: Supported Automatically Adjust Brightness: No Connection Type: Thunderbolt/DisplayPort Installed Packages: alabaster: 0.7.13 appdirs: 1.4.4 appnope: 0.1.3 asttokens: 2.2.1 Babel: 2.12.1 backcall: 0.2.0 beautifulsoup4: 4.11.2 blockdiag: 3.0.0 build: 0.10.0 certifi: 2021.10.8 cftime: 1.6.2 charset-normalizer: 3.1.0 ChimeraX-AddCharge: 1.5.9.1 ChimeraX-AddH: 2.2.5 ChimeraX-AlignmentAlgorithms: 2.0.1 ChimeraX-AlignmentHdrs: 3.3.1 ChimeraX-AlignmentMatrices: 2.1 ChimeraX-Alignments: 2.9.3 ChimeraX-AlphaFold: 1.0 ChimeraX-AltlocExplorer: 1.0.3 ChimeraX-AmberInfo: 1.0 ChimeraX-Arrays: 1.1 ChimeraX-Atomic: 1.43.10 ChimeraX-AtomicLibrary: 10.0.6 ChimeraX-AtomSearch: 2.0.1 ChimeraX-AxesPlanes: 2.3.2 ChimeraX-BasicActions: 1.1.2 ChimeraX-BILD: 1.0 ChimeraX-BlastProtein: 2.1.2 ChimeraX-BondRot: 2.0.1 ChimeraX-BugReporter: 1.0.1 ChimeraX-BuildStructure: 2.8 ChimeraX-Bumps: 1.0 ChimeraX-BundleBuilder: 1.2.2 ChimeraX-ButtonPanel: 1.0.1 ChimeraX-CageBuilder: 1.0.1 ChimeraX-CellPack: 1.0 ChimeraX-Centroids: 1.3.2 ChimeraX-ChangeChains: 1.0.2 ChimeraX-CheckWaters: 1.3.1 ChimeraX-ChemGroup: 2.0.1 ChimeraX-Clashes: 2.2.4 ChimeraX-ColorActions: 1.0.3 ChimeraX-ColorGlobe: 1.0 ChimeraX-ColorKey: 1.5.3 ChimeraX-CommandLine: 1.2.5 ChimeraX-ConnectStructure: 2.0.1 ChimeraX-Contacts: 1.0.1 ChimeraX-Core: 1.6.1 ChimeraX-CoreFormats: 1.1 ChimeraX-coulombic: 1.4.2 ChimeraX-Crosslinks: 1.0 ChimeraX-Crystal: 1.0 ChimeraX-CrystalContacts: 1.0.1 ChimeraX-DataFormats: 1.2.3 ChimeraX-Dicom: 1.2 ChimeraX-DistMonitor: 1.4 ChimeraX-DockPrep: 1.1.1 ChimeraX-Dssp: 2.0 ChimeraX-EMDB-SFF: 1.0 ChimeraX-ESMFold: 1.0 ChimeraX-FileHistory: 1.0.1 ChimeraX-FunctionKey: 1.0.1 ChimeraX-Geometry: 1.3 ChimeraX-gltf: 1.0 ChimeraX-Graphics: 1.1.1 ChimeraX-Hbonds: 2.4 ChimeraX-Help: 1.2.1 ChimeraX-HKCage: 1.3 ChimeraX-IHM: 1.1 ChimeraX-ImageFormats: 1.2 ChimeraX-IMOD: 1.0 ChimeraX-IO: 1.0.1 ChimeraX-ItemsInspection: 1.0.1 ChimeraX-Label: 1.1.7 ChimeraX-ListInfo: 1.1.1 ChimeraX-Log: 1.1.5 ChimeraX-LookingGlass: 1.1 ChimeraX-Maestro: 1.8.2 ChimeraX-Map: 1.1.4 ChimeraX-MapData: 2.0 ChimeraX-MapEraser: 1.0.1 ChimeraX-MapFilter: 2.0.1 ChimeraX-MapFit: 2.0 ChimeraX-MapSeries: 2.1.1 ChimeraX-Markers: 1.0.1 ChimeraX-Mask: 1.0.2 ChimeraX-MatchMaker: 2.0.12 ChimeraX-MDcrds: 2.6 ChimeraX-MedicalToolbar: 1.0.2 ChimeraX-Meeting: 1.0.1 ChimeraX-MLP: 1.1.1 ChimeraX-mmCIF: 2.12 ChimeraX-MMTF: 2.2 ChimeraX-Modeller: 1.5.9 ChimeraX-ModelPanel: 1.3.7 ChimeraX-ModelSeries: 1.0.1 ChimeraX-Mol2: 2.0 ChimeraX-Mole: 1.0 ChimeraX-Morph: 1.0.2 ChimeraX-MouseModes: 1.2 ChimeraX-Movie: 1.0 ChimeraX-Neuron: 1.0 ChimeraX-Nifti: 1.0 ChimeraX-NRRD: 1.0 ChimeraX-Nucleotides: 2.0.3 ChimeraX-OpenCommand: 1.10.1 ChimeraX-PDB: 2.7.2 ChimeraX-PDBBio: 1.0 ChimeraX-PDBLibrary: 1.0.2 ChimeraX-PDBMatrices: 1.0 ChimeraX-PickBlobs: 1.0.1 ChimeraX-Positions: 1.0 ChimeraX-PresetMgr: 1.1 ChimeraX-PubChem: 2.1 ChimeraX-ReadPbonds: 1.0.1 ChimeraX-Registration: 1.1.1 ChimeraX-RemoteControl: 1.0 ChimeraX-RenderByAttr: 1.1 ChimeraX-RenumberResidues: 1.1 ChimeraX-ResidueFit: 1.0.1 ChimeraX-RestServer: 1.1 ChimeraX-RNALayout: 1.0 ChimeraX-RotamerLibMgr: 3.0 ChimeraX-RotamerLibsDunbrack: 2.0 ChimeraX-RotamerLibsDynameomics: 2.0 ChimeraX-RotamerLibsRichardson: 2.0 ChimeraX-SaveCommand: 1.5.1 ChimeraX-SchemeMgr: 1.0 ChimeraX-SDF: 2.0.1 ChimeraX-Segger: 1.0 ChimeraX-Segment: 1.0.1 ChimeraX-SelInspector: 1.0 ChimeraX-SeqView: 2.8.3 ChimeraX-Shape: 1.0.1 ChimeraX-Shell: 1.0.1 ChimeraX-Shortcuts: 1.1.1 ChimeraX-ShowSequences: 1.0.1 ChimeraX-SideView: 1.0.1 ChimeraX-Smiles: 2.1 ChimeraX-SmoothLines: 1.0 ChimeraX-SpaceNavigator: 1.0 ChimeraX-StdCommands: 1.10.3 ChimeraX-STL: 1.0.1 ChimeraX-Storm: 1.0 ChimeraX-StructMeasure: 1.1.2 ChimeraX-Struts: 1.0.1 ChimeraX-Surface: 1.0.1 ChimeraX-SwapAA: 2.0.1 ChimeraX-SwapRes: 2.2.1 ChimeraX-TapeMeasure: 1.0 ChimeraX-Test: 1.0 ChimeraX-Toolbar: 1.1.2 ChimeraX-ToolshedUtils: 1.2.1 ChimeraX-Topography: 1.0 ChimeraX-Tug: 1.0.1 ChimeraX-UI: 1.28.4 ChimeraX-uniprot: 2.2.2 ChimeraX-UnitCell: 1.0.1 ChimeraX-ViewDockX: 1.2 ChimeraX-VIPERdb: 1.0 ChimeraX-Vive: 1.1 ChimeraX-VolumeMenu: 1.0.1 ChimeraX-VTK: 1.0 ChimeraX-WavefrontOBJ: 1.0 ChimeraX-WebCam: 1.0.2 ChimeraX-WebServices: 1.1.1 ChimeraX-Zone: 1.0.1 colorama: 0.4.6 comm: 0.1.3 contourpy: 1.0.7 cxservices: 1.2.2 cycler: 0.11.0 Cython: 0.29.33 debugpy: 1.6.7 decorator: 5.1.1 docutils: 0.19 executing: 1.2.0 filelock: 3.9.0 fonttools: 4.39.3 funcparserlib: 1.0.1 grako: 3.16.5 h5py: 3.8.0 html2text: 2020.1.16 idna: 3.4 ihm: 0.35 imagecodecs: 2022.2.22 imagesize: 1.4.1 importlib-metadata: 6.6.0 ipykernel: 6.21.1 ipython: 8.10.0 ipython-genutils: 0.2.0 ipywidgets: 8.0.6 jedi: 0.18.2 Jinja2: 3.1.2 jupyter-client: 8.0.2 jupyter-core: 5.3.0 jupyterlab-widgets: 3.0.7 kiwisolver: 1.4.4 line-profiler: 4.0.2 lxml: 4.9.2 lz4: 4.3.2 MarkupSafe: 2.1.2 matplotlib: 3.6.3 matplotlib-inline: 0.1.6 msgpack: 1.0.4 nest-asyncio: 1.5.6 netCDF4: 1.6.2 networkx: 2.8.8 nibabel: 5.0.1 nptyping: 2.5.0 numexpr: 2.8.4 numpy: 1.23.5 openvr: 1.23.701 packaging: 21.3 ParmEd: 3.4.3 parso: 0.8.3 pep517: 0.13.0 pexpect: 4.8.0 pickleshare: 0.7.5 Pillow: 9.3.0 pip: 23.0 pkginfo: 1.9.6 platformdirs: 3.5.0 prompt-toolkit: 3.0.38 psutil: 5.9.4 ptyprocess: 0.7.0 pure-eval: 0.2.2 pycollada: 0.7.2 pydicom: 2.3.0 Pygments: 2.14.0 pynrrd: 1.0.0 PyOpenGL: 3.1.5 PyOpenGL-accelerate: 3.1.5 pyparsing: 3.0.9 pyproject-hooks: 1.0.0 PyQt6-commercial: 6.4.2 PyQt6-Qt6: 6.4.3 PyQt6-sip: 13.4.1 PyQt6-WebEngine-commercial: 6.4.0 PyQt6-WebEngine-Qt6: 6.4.3 python-dateutil: 2.8.2 pytz: 2023.3 pyzmq: 25.0.2 qtconsole: 5.4.0 QtPy: 2.3.1 RandomWords: 0.4.0 requests: 2.28.2 scipy: 1.9.3 setuptools: 67.4.0 setuptools-scm: 7.0.5 sfftk-rw: 0.7.3 six: 1.16.0 snowballstemmer: 2.2.0 sortedcontainers: 2.4.0 soupsieve: 2.4.1 sphinx: 6.1.3 sphinx-autodoc-typehints: 1.22 sphinxcontrib-applehelp: 1.0.4 sphinxcontrib-blockdiag: 3.0.0 sphinxcontrib-devhelp: 1.0.2 sphinxcontrib-htmlhelp: 2.0.1 sphinxcontrib-jsmath: 1.0.1 sphinxcontrib-qthelp: 1.0.3 sphinxcontrib-serializinghtml: 1.1.5 stack-data: 0.6.2 tables: 3.7.0 tcia-utils: 1.2.0 tifffile: 2022.10.10 tinyarray: 1.2.4 tomli: 2.0.1 tornado: 6.3.1 traitlets: 5.9.0 typing-extensions: 4.5.0 tzdata: 2023.3 urllib3: 1.26.15 wcwidth: 0.2.6 webcolors: 1.12 wheel: 0.38.4 wheel-filename: 1.4.1 widgetsnbextension: 4.0.7 zipp: 3.15.0 }}} " defect new normal Unassigned